ORFeome > scap ORF1 – XORFeome v1.0

scap ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: scap
Gene ID: 996524
Gene Page ID: 996520
ORF Xenbase ID: 17295261

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC127423
Original XGC clone length: 3936

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ837441
dbEST ID: 79655143
Trimmed Sequence: ATGCCCCTGATTGACAAGCTGCGTGAGAGGATATCACGAGCCTTCTACAGCCACGGGCTGCTCTGTGCCTCCTACCCTATCCCCATCATCATCCTCACTGCTCTCTGCATTCTGGCCTCCTGTTACCCCCTGCTAAAGCTTCCGCTGCCTGGGACTGGCCCAGTTGAGTACGTCACCTCAGTGAAAGATTATTCACCTCCACCTTTAGAGCCGAACCCAGAGGACCACAGCGACCAACCTGATTGGTACGTGGGGCTGCCCGTGGCCTTCATACAGCAGGTGTTGGTTAAAGCTGTCGTATCTCCGTGGGACAAGGACTTCCTGGCTGTGGATGTTTTCCGGTCTCCACTGTCTCGTGTCTTTCCATTGGTGGAAGAGATCAGGAACCACGTGCTTAGAGACAAATCCCAGGAGAAGAGTCTAGAAGATGTGTGTCTCCAGGTGACAGACCTGCTGCCTGGCCTGAAGAAGTTCCGTGACAAGTTACCTGAACATGGCTGCCTACTACTTTCTCCAGCCAACTTCTGGCAGAACAGCCAAGAACAGTTCAGCAGTGACCCAGACCTTATCAGAACCATCCATCAGCATGAGCCCAAGACCTTACAGACCTCTGCTACTCTCAAAGACTTGCTTTTTGGAGTCCCAGGAAAGCAGAGCGGAGTCAGTTTGTACAACCGCAAGAGAATGTATCCTAACACGTCAACCATCGCTCTTCGCAAATACAAATGCACCCTTCCTTGGACAGTTTAAGGTCCCCGACTCAGGCGGGCAAAACCCCCAGCACCAAACTCCCAGCCCAAACCCATTTTAACCAA
Full Trace Sequence: GGAATTTTTTATTTTTTAGACTGGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCCTGATTGACAAGCTGCGTGAGAGGATATCACGAGCCTTCTACAGCCACGGGCTGCTCTGTGCCTCCTACCCTATCCCCATCATCATCCTCACTGCTCTCTGCATTCTGGCCTCCTGTTACCCCCTGCTAAAGCTTCCGCTGCCTGGGACTGGCCCAGTTGAGTACGTCACCTCAGTGAAAGATTATTCACCTCCACCTTTAGAGCCGAACCCAGAGGACCACAGCGACCAACCTGATTGGTACGTGGGGCTGCCCGTGGCCTTCATACAGCAGGTGTTGGTTAAAGCTGTCGTATCTCCGTGGGACAAGGACTTCCTGGCTGTGGATGTTTTCCGGTCTCCACTGTCTCGTGTCTTTCCATTGGTGGAAGAGATCAGGAACCACGTGCTTAGAGACAAATCCCAGGAGAAGAGTCTAGAAGATGTGTGTCTCCAGGTGACAGACCTGCTGCCTGGCCTGAAGAAGTTCCGTGACAAGTTACCTGAACATGGCTGCCTACTACTTTCTCCAGCCAACTTCTGGCAGAACAGCCAAGAACAGTTCAGCAGTGACCCAGACCTTATCAGAACCATCCATCAGCATGAGCCCAAGACCTTACAGACCTCTGCTACTCTCAAAGACTTGCTTTTTGGAGTCCCAGGAAAGCAGAGCGGAGTCAGTTTGTACAACCGCAAGAGAATGTATCCTAACACGTCAACCATCGCTCTTCGCAAATACAAATGCACCCTTCCTTGGACAGTTTAAGGTCCCCGACTCAGGCGGGCAAAACCCCCAGCACCAAACTCCCAGCCCAAACCCATTTTAACCAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCCTGATTGACAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837440
dbEST ID: 79655142
Trimmed Sequence: GTCGAGCTTCTCCAGCACAGAGGGGACGTAGACCAGGCTCAGCTCACTGCCAAAGTCACACACTATAGCCGAATTGTCCAACACTAGAATGTGACGCGCCGGCTGCGAATCCTCACACTTCCCCAGATAAACCGTCTGCAAGAGGTCCCCATAACCAACGTCCCAGAAAGACACACAGCCCAGTCCTCCTGTAACGAGGAGGTTGTCTGAGATGAGCCCCAAGCTGGAACCACAGCCCAAATCCTGCTGGATGGAGTAGAGTTTAATCGCTGTGCTCCTGTCCCATATGCTGATGACATCATCCAGCCCACTGCTGATTACACAGGAAGCAGTGCAAAGCAAAGACGTGACATCACCACGGTGCCCGAACATGTGACTGACCCGGCTTCCTGTCAATACATCCCACAGGCAGATTGCTCCATCCTGCCCCCCGCTGGCCAGAACCATCGTCTCATCGATATAAATGGCCGTGATTCCACCCGAGTGTCCCTGAAGAGTGAAGAGGCAACAGGCATCCTCCAGGCGGTATATTCTCACTGTGTGGTCCTGGCTCCCTGTCACTAGCCGGCCTGCTGCTGCTTTCAGGGCAGTGATTGGCTTCCGGTGGGCACAGGCCACTGTATGGGTCCGCTGGCAGCCAATGACATCATCAGTACTGTACAGTGGGGGAGCTGGGGACATTGCCTTCT
Full Trace Sequence: GAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTCGAGCTTCTCCAGCACAGAGGGGACGTAGACCAGGCTCAGCTCACTGCCAAAGTCACACACTATAGCCGAATTGTCCAACACTAGAATGTGACGCGCCGGCTGCGAATCCTCACACTTCCCCAGATAAACCGTCTGCAAGAGGTCCCCATAACCAACGTCCCAGAAAGACACACAGCCCAGTCCTCCTGTAACGAGGAGGTTGTCTGAGATGAGCCCCAAGCTGGAACCACAGCCCAAATCCTGCTGGATGGAGTAGAGTTTAATCGCTGTGCTCCTGTCCCATATGCTGATGACATCATCCAGCCCACTGCTGATTACACAGGAAGCAGTGCAAAGCAAAGACGTGACATCACCACGGTGCCCGAACATGTGACTGACCCGGCTTCCTGTCAATACATCCCACAGGCAGATTGCTCCATCCTGCCCCCCGCTGGCCAGAACCATCGTCTCATCGATATAAATGGCCGTGATTCCACCCGAGTGTCCCTGAAGAGTGAAGAGGCAACAGGCATCCTCCAGGCGGTATATTCTCACTGTGTGGTCCTGGCTCCCTGTCACTAGCCGGCCTGCTGCTGCTTTCAGGGCAGTGATTGGCTTCCGGTGGGCACAGGCCACTGTATGGGTCCGCTGGCAGCCAATGACATCATCAGTACTGTACAGTGGGGGAGCTGGGGACATTGCCTTCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCGAGCTTCTCCAGCA