ORFeome > scly ORF1 – XORFeome v1.0

scly ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: scly
Gene ID: 6077566
Gene Page ID: 485700
ORF Xenbase ID: 17295339

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC081243
Original XGC clone length: 1281

Human orthology & disease relationships

NCBI Entrez ID: 51540
Ensembl gene IDs: ENSG00000132330
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 180105,219500,606762

Library Location

Plate ID: GDExl11005
Well Location: G05

Sequences - 5ʹ (forward) EST

Accession: JZ839864
dbEST ID: 79657566
Trimmed Sequence: ATGGTAGACACAGAATCACAAAAGGAAAAGAATCATCTAAATCACAAGATTTACCTTGACTATAATGCTACTACTCCTCCTGCCAGAGAAGTGGTCGGCACTGTGGCAGAAGCTTTGCAAGAGGCCTGGGGCAACCCAAGCAGCAGCTATACTGCAGGATGCAAAGCCAAGGAGCTGATAGACACAGCACGAGCTCGCATTGCCAAGATGGTGGGAGGAAAACCTGAAGATATTATTTTTACCTCTGGGGGCACAGAGGCTAACAATATGGTGCTTTTCTCTGCCGTGGAGAATTTTAACAGAACATCCAAAGAAAGGCAGAATAACAATGTGGACTGGGCATTACCTCACATCATTACATCAAATGTTGAGCATGACTCTGTGGCACTACCACTCTTACAACTACAGAAGACTCATAAAGCTGAAATTACATTTGTCCCAGTCTCTACTGTAACGGGTCGTGTAGAGGTTGAAGATGTCATTTCTGCTGTACGTCCCAATACTTGTTTGGTGTCCATCATGCTGGCAAACAATGAAACTGGAGTCATTATGCCTGTGGGTGAGCTTTCCCAGTGCTTGGCTTCCCTTTCTAGAAAAAGATCTGCACAAGGGCTTCCCGAGATCCTACTGCACACGGATGCTGCCCAGCCTTGGGAAAGGTGGGAAATGGATGTGCAAGAACTGGGAGTAAATTATCTGAACCATGTTTGGACACAAATTTCTATGGGGCCACCCATTGGAAACCCTTTTAATGGTTGGAAGGGCCTCGGGGCACCCAGTTCTTCTTTTGCTTCCCCCATTGCCTTTTTTTT
Full Trace Sequence: TCGTGGGCCCAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTAGACACAGAATCACAAAAGGAAAAGAATCATCTAAATCACAAGATTTACCTTGACTATAATGCTACTACTCCTCCTGCCAGAGAAGTGGTCGGCACTGTGGCAGAAGCTTTGCAAGAGGCCTGGGGCAACCCAAGCAGCAGCTATACTGCAGGATGCAAAGCCAAGGAGCTGATAGACACAGCACGAGCTCGCATTGCCAAGATGGTGGGAGGAAAACCTGAAGATATTATTTTTACCTCTGGGGGCACAGAGGCTAACAATATGGTGCTTTTCTCTGCCGTGGAGAATTTTAACAGAACATCCAAAGAAAGGCAGAATAACAATGTGGACTGGGCATTACCTCACATCATTACATCAAATGTTGAGCATGACTCTGTGGCACTACCACTCTTACAACTACAGAAGACTCATAAAGCTGAAATTACATTTGTCCCAGTCTCTACTGTAACGGGTCGTGTAGAGGTTGAAGATGTCATTTCTGCTGTACGTCCCAATACTTGTTTGGTGTCCATCATGCTGGCAAACAATGAAACTGGAGTCATTATGCCTGTGGGTGAGCTTTCCCAGTGCTTGGCTTCCCTTTCTAGAAAAAGATCTGCACAAGGGCTTCCCGAGATCCTACTGCACACGGATGCTGCCCAGCCTTGGGAAAGGTGGGAAATGGATGTGCAAGAACTGGGAGTAAATTATCTGAACCATGTTTGGACACAAATTTCTATGGGGCCACCCATTGGAAACCCTTTTAATGGTTGGAAGGGCCTCGGGGCACCCAGTTCTTCTTTTGCTTCCCCCATTGCCTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAGACACAGAATCACAAAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839863
dbEST ID: 79657565
Trimmed Sequence: GCTTTGTTTATTCATTCCAAGTAACTGGGCTGCTTGTTCAAGGTCTCTGACAATCAAATCCACATCATCCTGAGATGTTTCTCGCCCCACACTTAGACGCACTGCAGATCTCGCAGCATCTTGCGGCACGCCACTCTTTAGCAGCACCGGTGATGGACTGTCTCCCCGGTCTGAATGGCATGCTGCTCCGACGCTAGCCTGAAGGTACTGACAGTGAGAAAGCCACTCACGTCCAAGCACTGCAGGTTTCAGAAGTGACACGTTGCAGGTGTTTGGAAGCCGTTCTGCTCCAGGGAACCGAGAGTTCAATCGGATTCGGTCTCCAAACACAGCCTCCAGCTTTTGCTCCAGATAATCCCGTATGCGTCTCATGTGAACCTCATAAGCAGCACAATGTAAGGACACAAGCTCTGCAGCCTGTCCAAGCCCTGCTATCATTGGTGTGTTCTCTGTTCCTGGGCGAAAGTTGCCCTCTCGTCCTCCTCCATAAAGCATGGGGAGCAAAGGAGACTGGTGCCCGAGGCCTCCAACATANCAGGCTCCCATGCGTGGCCCATAGAACTTGTGTCCAACAATGGTCAGATAATTTACTCCCAGTTCTTGCACATCCACTTCCACCTTTCCCAAGGCTTGGGCAGCATCCGTGTGCAGTAGGATCTCGGGAAAGCCCTTGTGCAGATCNTTTTTCTAGAAAGGGGAAGCCAAGCACTGGGGAAAACTCACCCAACGGGCAATAAGGACTTCCCGGTTTTTCATTTGGTTTGCCCCG
Full Trace Sequence: GAAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGAATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTTTGTTTATTCATTCCAAGTAACTGGGCTGCTTGTTCAAGGTCTCTGACAATCAAATCCACATCATCCTGAGATGTTTCTCGCCCCACACTTAGACGCACTGCAGATCTCGCAGCATCTTGCGGCACGCCACTCTTTAGCAGCACCGGTGATGGACTGTCTCCCCGGTCTGAATGGCATGCTGCTCCGACGCTAGCCTGAAGGTACTGACAGTGAGAAAGCCACTCACGTCCAAGCACTGCAGGTTTCAGAAGTGACACGTTGCAGGTGTTTGGAAGCCGTTCTGCTCCAGGGAACCGAGAGTTCAATCGGATTCGGTCTCCAAACACAGCCTCCAGCTTTTGCTCCAGATAATCCCGTATGCGTCTCATGTGAACCTCATAAGCAGCACAATGTAAGGACACAAGCTCTGCAGCCTGTCCAAGCCCTGCTATCATTGGTGTGTTCTCTGTTCCTGGGCGAAAGTTGCCCTCTCGTCCTCCTCCATAAAGCATGGGGAGCAAAGGAGACTGGTGCCCGAGGCCTCCAACATANCAGGCTCCCATGCGTGGCCCATAGAACTTGTGTCCAACAATGGTCAGATAATTTACTCCCAGTTCTTGCACATCCACTTCCACCTTTCCCAAGGCTTGGGCAGCATCCGTGTGCAGTAGGATCTCGGGAAAGCCCTTGTGCAGATCNTTTTTCTAGAAAGGGGAAGCCAAGCACTGGGGAAAACTCACCCAACGGGCAATAAGGACTTCCCGGTTTTTCATTTGGTTTGCCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTTTGTTTATTCATTCCAAGT