ORFeome > scn4b ORF1 – XORFeome v1.0

scn4b ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: scn4b
Gene ID: 921521
Gene Page ID: 921509
ORF Xenbase ID: 17295363

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC060028
Original XGC clone length: 717

Human orthology & disease relationships

NCBI Entrez ID: 6330
Ensembl gene IDs: ENSG00000177098,LRG_330
Directly associated (OMIM) disease MIM numbers: 611819
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11017
Well Location: C11

Sequences - 5ʹ (forward) EST

Accession: JZ824437
dbEST ID: 79642139
Trimmed Sequence: ATGACCGTGCGACCCCTTTGGGACAGACGCGACTCCTACTGGAGGCGCCACTCGCGGCTTGTTGCCCTCTGCTTCATTGTGCTTTTTGCCCACTCGTGTTTGCCTCTGGAGGTGTCGGTAGGCAAGAATAACCTGATCACAGCTATCAATGGGTCTAATGTAACGCTCCCCTGTACTTTCATGGCCTGCATTGGCTTCAGTGGTGTTACCTTCTCTTGGGTATACAGCTCTCTCAACAGTTCGCTTAAACCTGAGGACCTTTATAAAGGGACACTGAAGGACAAGAAGTCATCCCCTAAACCTGAAGTCATTTTCAACAGGAATGAACGTATGGATCGGGTACAGCTTGTTCCCAACAATACAACCAAAGATTACGAACTATCCCTGCTTTTGAAGAATGTGGATTTTGATGACATTGGGCGCTATACCTGTGTTGTGAAGAATGAGAAAGAAAAGGGTGCCACACACAATGCCACCATTATACTGAAAGTGGTAGACAAATTTGAGGATGTGGATAATACACTGACTCTAATTATCGTGGCTGCAGTTGGTGGAGTGATTGGACTTCTTATACTTATCCTTATAATGAAGAAAATTATTACCTTCATTATTAAGAGGAACCGTGACAAGAAGAAGGACTGCCTTGTAAGCTCTTCTGTTAATGANCATACTGACAATGCCTCCAAACAAGAAAGCAAGGCCAAAACCAAAAGCATGCCNACTTTTCTTGTAACAAGTTGGCATTTATAGAAAGCATTGCNTTATCAATTTGGTTGCAACGAACCAGGTCACCTAATAATTCAAAAAAAAAAATCCAT
Full Trace Sequence: CAGTATTGATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACCGTGCGACCCCTTTGGGACAGACGCGACTCCTACTGGAGGCGCCACTCGCGGCTTGTTGCCCTCTGCTTCATTGTGCTTTTTGCCCACTCGTGTTTGCCTCTGGAGGTGTCGGTAGGCAAGAATAACCTGATCACAGCTATCAATGGGTCTAATGTAACGCTCCCCTGTACTTTCATGGCCTGCATTGGCTTCAGTGGTGTTACCTTCTCTTGGGTATACAGCTCTCTCAACAGTTCGCTTAAACCTGAGGACCTTTATAAAGGGACACTGAAGGACAAGAAGTCATCCCCTAAACCTGAAGTCATTTTCAACAGGAATGAACGTATGGATCGGGTACAGCTTGTTCCCAACAATACAACCAAAGATTACGAACTATCCCTGCTTTTGAAGAATGTGGATTTTGATGACATTGGGCGCTATACCTGTGTTGTGAAGAATGAGAAAGAAAAGGGTGCCACACACAATGCCACCATTATACTGAAAGTGGTAGACAAATTTGAGGATGTGGATAATACACTGACTCTAATTATCGTGGCTGCAGTTGGTGGAGTGATTGGACTTCTTATACTTATCCTTATAATGAAGAAAATTATTACCTTCATTATTAAGAGGAACCGTGACAAGAAGAAGGACTGCCTTGTAAGCTCTTCTGTTAATGANCATACTGACAATGCCTCCAAACAAGAAAGCAAGGCCAAAACCAAAAGCATGCCNACTTTTCTTGTAACAAGTTGGCATTTATAGAAAGCATTGCNTTATCAATTTGGTTGCAACGAACCAGGTCACCTAATAATTCAAAAAAAAAAATCCAT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCGTGCGACCCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ829793
dbEST ID: 79647495
Trimmed Sequence: TGCTTTGGGTTTGGCCTTGCTTTCTTGTTTGGAGGCATTGTCAGTATTGTCATTAACAGAAGAGCTTACAAGGCAGTCCTTCTTCTTGTCACGGTTCCTCTTAATAATGAAGGTAATAATTTTCTTCATTATAAGGATAAGTATAAGAAGTCCAATCACTCCACCAACTGCAGCCACGATAATTAGAGTCAGTGTATTATCCACATCCTCAAATTTGTCTACCACTTTCAGTATAATGGTGGCATTGTGTGTGGCACCCTTTTCTTTCTCATTCTTCACAACACAGGTATAGCGCCCAATGTCATCAAAATCCACATTCTTCAAAAGCAGGGATAGTTCGTAATCTTTGGTTGTATTGTTGGGAACAAGCTGTACCCGATCCATACGTTCATTCCTGTTGAAAATGACTTCAGGTTTAGGGGATGACTTCTTGTCCTTCAGTGTCCCTTTATAAAGGTCCTCAGGTTTAAGCGAACTGTTGAGAGAGCTGTATACCCAAGAGAAGGTAACACCACTGAAGCCAATGCANGCCATGAAAGTACAGGGGAGCGTTACATTAGACCCATTGATAGCTGTGATCAGGTTATTCTTGCCTACCGACACCTCCCGAGGCAAACACGAGTGGGCAAAAAGCACAATGAAGCAGAGGGCACAAGGCCGCGAGTGGCGCCTCCAGTAGGAGTCGCGTCTGTTCCAAAGGGGTCGCAGCGTCAGGTGGCCAACTTTTTTTGTACAAAGTTGGGCATTTTTAAAAAAAGCATTGCTTAATCAAATT
Full Trace Sequence: CGTGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGCTTTGGGTTTGGCCTTGCTTTCTTGTTTGGAGGCATTGTCAGTATTGTCATTAACAGAAGAGCTTACAAGGCAGTCCTTCTTCTTGTCACGGTTCCTCTTAATAATGAAGGTAATAATTTTCTTCATTATAAGGATAAGTATAAGAAGTCCAATCACTCCACCAACTGCAGCCACGATAATTAGAGTCAGTGTATTATCCACATCCTCAAATTTGTCTACCACTTTCAGTATAATGGTGGCATTGTGTGTGGCACCCTTTTCTTTCTCATTCTTCACAACACAGGTATAGCGCCCAATGTCATCAAAATCCACATTCTTCAAAAGCAGGGATAGTTCGTAATCTTTGGTTGTATTGTTGGGAACAAGCTGTACCCGATCCATACGTTCATTCCTGTTGAAAATGACTTCAGGTTTAGGGGATGACTTCTTGTCCTTCAGTGTCCCTTTATAAAGGTCCTCAGGTTTAAGCGAACTGTTGAGAGAGCTGTATACCCAAGAGAAGGTAACACCACTGAAGCCAATGCANGCCATGAAAGTACAGGGGAGCGTTACATTAGACCCATTGATAGCTGTGATCAGGTTATTCTTGCCTACCGACACCTCCCGAGGCAAACACGAGTGGGCAAAAAGCACAATGAAGCAGAGGGCACAAGGCCGCGAGTGGCGCCTCCAGTAGGAGTCGCGTCTGTTCCAAAGGGGTCGCAGCGTCAGGTGGCCAACTTTTTTTGTACAAAGTTGGGCATTTTTAAAAAAAGCATTGCTTAATCAAATT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCTTTGGGTTTGGCCTT