ORFeome > scnn1d ORF1 – XORFeome v1.0

scnn1d ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: scnn1d
Gene ID: 991877
Gene Page ID: 991875
ORF Xenbase ID: 17295387

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC126033
Original XGC clone length: 1812

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ837562
dbEST ID: 79655264
Trimmed Sequence: ATGGAGTCCACAGAAAAAGAGAAAAAGGAAGGCTTGATCGAATTTTATGACTCCTTTGAAGATATGCTAACGTTTTTCTGTGACAACACCACAATCCATGGCACTGTCCGTCTCAACTGCTCTCGAAAGAACAAAATGAAGACCACTTTCTGGCTTGTGCTTTACTTTGTCTCATTTGCTATGATGTATTGGCAGTTTGGGCAATTAACAGATCAATATTGGGCTTATCCTACCAGCACAATTATAGGCTTGCAGTCAAAGGGCAAAATATTTCCAGCTGTGACCATTTGCAATCTGAACCCCTACAGATTTGATCAAGTTAATATGTATATTAATCAGCTCGACCAACTAGCAAATGAAACACTTTATTCACTATATGAATATCGCGCTCCAGAGTCAGGACAGCAAGTTGTTGATCTACAGGATCTCCTAAACAATTTGACAGGCCAAGTCAATGGAGGTTTTTATTTGGATGAAAGCATTGTGCTGCTGAAGTTGCAAGAGAATGGTTCGGGCCCAGCTTTACCAGGGGAGAAGAGATTTAAAGTAGGATTTAAGCTGTGTAATTCCTCAAGAGACGATTGCTACTATGAAGTGTTTTGGTCTGGAGTTAATGCTCTCCCCGAATGGTACAAATTCCACTACATAAACATCATGTCCAATATACCTGCTGTGCTGAACATAGCAAATATTTTTTCTAACGGATTCATTTTTATCTTTTCCATTTTAACCAGGGTACCCTTGGTGCTGACCGGGAAAGAGATTTCCTTTTTCCTTCCCCCCCCC
Full Trace Sequence: GAGGGCCCCAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCACAGAAAAAGAGAAAAAGGAAGGCTTGATCGAATTTTATGACTCCTTTGAAGATATGCTAACGTTTTTCTGTGACAACACCACAATCCATGGCACTGTCCGTCTCAACTGCTCTCGAAAGAACAAAATGAAGACCACTTTCTGGCTTGTGCTTTACTTTGTCTCATTTGCTATGATGTATTGGCAGTTTGGGCAATTAACAGATCAATATTGGGCTTATCCTACCAGCACAATTATAGGCTTGCAGTCAAAGGGCAAAATATTTCCAGCTGTGACCATTTGCAATCTGAACCCCTACAGATTTGATCAAGTTAATATGTATATTAATCAGCTCGACCAACTAGCAAATGAAACACTTTATTCACTATATGAATATCGCGCTCCAGAGTCAGGACAGCAAGTTGTTGATCTACAGGATCTCCTAAACAATTTGACAGGCCAAGTCAATGGAGGTTTTTATTTGGATGAAAGCATTGTGCTGCTGAAGTTGCAAGAGAATGGTTCGGGCCCAGCTTTACCAGGGGAGAAGAGATTTAAAGTAGGATTTAAGCTGTGTAATTCCTCAAGAGACGATTGCTACTATGAAGTGTTTTGGTCTGGAGTTAATGCTCTCCCCGAATGGTACAAATTCCACTACATAAACATCATGTCCAATATACCTGCTGTGCTGAACATAGCAAATATTTTTTCTAACGGATTCATTTTTATCTTTTCCATTTTAACCAGGGTACCCTTGGTGCTGACCGGGAAAGAGATTTCCTTTTTCCTTCCCCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGTCCACAGAAAAAGAGAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837561
dbEST ID: 79655263
Trimmed Sequence: GGAAAAGGTATTTATTTCCCCATTAAATTTGGGGTCATTTGTTTTGCTTTCTAATTCTTTTTCAGACAGCCCAGTCTGGGGAGTGGAGAAAGTCTTGCTGTCGATGTAAGGTACAGAGCACACGTTACTGGCTGCATTGCTTCCATTCATGCCATCATTTCTATTTGCCCTCTGCTTTTTCCATTGGTATATAACAATGGTTACCATGGCCGCAGTATCAAGCACAAGTTCTGCAATCTCAGCCACTGAAAGAACTGAAGAACCAAACCACCAGCTCCATAGTCCTCCCATACTGGAGAGCAACACGTTCACCGACATGGTAGGTGTTTCCTCAACGGACCGGTAACTCAGCTCTTCATAATACACATTAATCTTTGAAACATCGCTCCTTTCGCTGGTACTGTTGTATCTTTCTTGCAAGGATAGCAATTGTATTGCCTTGGATACAGGAGATGGCCACTTGGCAGTCCCCGCAGCAAGGTGATATTGGGTCTGCTTGCATTGCTTTGGACATTGGGTAAAGCAGATGAGTGTGTGGTCTAGCATCTTTTCGTATAATTGGTAGAAACAATGCCCCCAGCCAGGATACTTGTTATAGTTGCAGTATTCCCTGCCGGGAGGCAGAAGATAAAAATAATATCCACATCCACACCTTTTCATCATTTTGTACTGGAAACAAAAAATCAAGCATGCCCTGCATTTGGGTAGAAATGTGTTTTTAAAGTATTTTTAATGCCTTAAAACCACTTGGCCATCAGAAATGGT
Full Trace Sequence: GGAAAACTGTCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAAAAGGTATTTATTTCCCCATTAAATTTGGGGTCATTTGTTTTGCTTTCTAATTCTTTTTCAGACAGCCCAGTCTGGGGAGTGGAGAAAGTCTTGCTGTCGATGTAAGGTACAGAGCACACGTTACTGGCTGCATTGCTTCCATTCATGCCATCATTTCTATTTGCCCTCTGCTTTTTCCATTGGTATATAACAATGGTTACCATGGCCGCAGTATCAAGCACAAGTTCTGCAATCTCAGCCACTGAAAGAACTGAAGAACCAAACCACCAGCTCCATAGTCCTCCCATACTGGAGAGCAACACGTTCACCGACATGGTAGGTGTTTCCTCAACGGACCGGTAACTCAGCTCTTCATAATACACATTAATCTTTGAAACATCGCTCCTTTCGCTGGTACTGTTGTATCTTTCTTGCAAGGATAGCAATTGTATTGCCTTGGATACAGGAGATGGCCACTTGGCAGTCCCCGCAGCAAGGTGATATTGGGTCTGCTTGCATTGCTTTGGACATTGGGTAAAGCAGATGAGTGTGTGGTCTAGCATCTTTTCGTATAATTGGTAGAAACAATGCCCCCAGCCAGGATACTTGTTATAGTTGCAGTATTCCCTGCCGGGAGGCAGAAGATAAAAATAATATCCACATCCACACCTTTTCATCATTTTGTACTGGAAACAAAAAATCAAGCATGCCCTGCATTTGGGTAGAAATGTGTTTTTAAAGTATTTTTAATGCCTTAAAACCACTTGGCCATCAGAAATGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAAAAGGTATTTATTTCCCCATT