ORFeome > sdad1 ORF1 – XORFeome v1.0

sdad1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sdad1
Gene ID: 1008737
Gene Page ID: 1008731
ORF Xenbase ID: 17295435

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108827
Original XGC clone length: 2070

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ837213
dbEST ID: 79654915
Trimmed Sequence: ATGTCGGGAAGGAATAATAACAAGCTGCCGACCAACCTGCCGCAGTTGCAGAACTTGATAAAGAGAGATCCTGCCTCCTACAGAGAAGAGTTTTTGCAGCAGTATAAGCACTACCTTTCTGTTATTGAAATATTTAAGCTTCAGCCAGACAAGCCAAATAAAGATTTGTCTACCTTGGTTATGTTTATGGCACAGACAGCACACTGTTTTCAACAATATCTGGAGGATTTTCCAGAGCAGTTGAAGTCTTTGCTATGTACACATCACACCGTGATGGATCCTGATCAGAGAATGACATTGTGCAAAGCTTTAATCATGTTACGGAATAAGAACTTAATAAGCCCATCAGTTCTTCTGGAACTATTCTTTGAGCTTCTGCGATGCCAAGATAAGCTTCTACGAAAAACTTTATACACTCATATTGTCACGGACATCAAGAATATAAATGCCAAACACAAGAACAACAAAGTCAATACGACTCTGCAGAATTTTATGTACACAATGCTAAGAGACAACAATGCCATTGCTGCAAAGATATCCCTTGATGTCATGATTGAGCTTTAAATACGGAACATCTGGAATGATGCCAAAACTGTTCACGTGATAACTACTGCCTTGTTATTTCTACGTCAATAAAAATTTTGGTTGGTGCGATGAAATTTCTTTTGGGGCAAATAGGAATACTAAGATACGGGAATATAATTAGGGAAACAAACGATGAAACCTGCCAAGCGCTGCACACACGTATCCGGAAATAAGTAA
Full Trace Sequence: TCGTGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGGAAGGAATAATAACAAGCTGCCGACCAACCTGCCGCAGTTGCAGAACTTGATAAAGAGAGATCCTGCCTCCTACAGAGAAGAGTTTTTGCAGCAGTATAAGCACTACCTTTCTGTTATTGAAATATTTAAGCTTCAGCCAGACAAGCCAAATAAAGATTTGTCTACCTTGGTTATGTTTATGGCACAGACAGCACACTGTTTTCAACAATATCTGGAGGATTTTCCAGAGCAGTTGAAGTCTTTGCTATGTACACATCACACCGTGATGGATCCTGATCAGAGAATGACATTGTGCAAAGCTTTAATCATGTTACGGAATAAGAACTTAATAAGCCCATCAGTTCTTCTGGAACTATTCTTTGAGCTTCTGCGATGCCAAGATAAGCTTCTACGAAAAACTTTATACACTCATATTGTCACGGACATCAAGAATATAAATGCCAAACACAAGAACAACAAAGTCAATACGACTCTGCAGAATTTTATGTACACAATGCTAAGAGACAACAATGCCATTGCTGCAAAGATATCCCTTGATGTCATGATTGAGCTTTAAATACGGAACATCTGGAATGATGCCAAAACTGTTCACGTGATAACTACTGCCTTGTTATTTCTACGTCAATAAAAATTTTGGTTGGTGCGATGAAATTTCTTTTGGGGCAAATAGGAATACTAAGATACGGGAATATAATTAGGGAAACAAACGATGAAACCTGCCAAGCGCTGCACACACGTATCCGGAAATAAGTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGGAAGGAATAATAACAAG

Sequences - 3ʹ (reverse) EST

Accession: JZ837212
dbEST ID: 79654914
Trimmed Sequence: TTTCATGAGCCTTTTCCTTTTCTTCAAAAGTGAATCTCGCAGTGCAATCTGCTTGTCCCGGAAAGAGCGCTTCTTTTTAGAACGAATATTTTGGCTATATCGCATCATCATGAAATTTTTGTTTTTTTTCTTTTCCTTGTTGGTGGAGCTGGCGTGGGGATTCATTTTTGTCTTTTTCCTTACAAATTCTTTTCTGTCTGTTCTTCTCGCCCAAACTGTAGCAAGTCTGGTATCTTTGTCACACTATAGCGGGCAATTGGATTGCCCGCTCTCTCCAGACTAGAGGGCATTTCCCATACGTGGCGCGTTCAAGATTTCATTCACTATAATTTTTTTGCTCGCAAACAGGTCTGTATCAGTCAAAATAAACTCATGGGGGGGGACCGGCCCTGAGGAGCAAGAGAGGGATGNCAAGACAGGAGAGAAGGGGAAAGNAAAGAAAGGGAAAGAAGGAGGAAGGGAGAAAAAAGGNGAAAGANTTGGAAGGGGGGAAGAGGAGGGAAGANGGAGAAGGAGAGAAANAGGAGAGGGAAGAGGGGAGAGAGGNAAAAGAAGAAGGAAGAGGAAGGGGGGGAGGGGGGGGGAGAAAGAGAGGGAGAAAGGGGGGAGAGAGGGGAAAGGGGAGAAGGGGAGGAGGGGGGGGGAGANGGAGGAAGGGGG
Full Trace Sequence: GGGGAATAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTTCATGAGCCTTTTCCTTTTCTTCAAAAGTGAATCTCGCAGTGCAATCTGCTTGTCCCGGAAAGAGCGCTTCTTTTTAGAACGAATATTTTGGCTATATCGCATCATCATGAAATTTTTGTTTTTTTTCTTTTCCTTGTTGGTGGAGCTGGCGTGGGGATTCATTTTTGTCTTTTTCCTTACAAATTCTTTTCTGTCTGTTCTTCTCGCCCAAACTGTAGCAAGTCTGGTATCTTTGTCACACTATAGCGGGCAATTGGATTGCCCGCTCTCTCCAGACTAGAGGGCATTTCCCATACGTGGCGCGTTCAAGATTTCATTCACTATAATTTTTTTGCTCGCAAACAGGTCTGTATCAGTCAAAATAAACTCATGGGGGGGGACCGGCCCTGAGGAGCAAGAGAGGGATGNCAAGACAGGAGAGAAGGGGAAAGNAAAGAAAGGGAAAGAAGGAGGAAGGGAGAAAAAAGGNGAAAGANTTGGAAGGGGGGAAGAGGAGGGAAGANGGAGAAGGAGAGAAANAGGAGAGGGAAGAGGGGAGAGAGGNAAAAGAAGAAGGAAGAGGAAGGGGGGGAGGGGGGGGGAGAAAGAGAGGGAGAAAGGGGGGAGAGAGGGGAAAGGGGAGAAGGGGAGGAGGGGGGGGGAGANGGAGGAAGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCATGAGCCTTTTCCTTTTCTT