ORFeome > sdf2 ORF1 – XORFeome v1.0

sdf2 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sdf2
Gene ID: 865856
Gene Page ID: 489306
ORF Xenbase ID: 17295483

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC082685
Original XGC clone length: 657

Human orthology & disease relationships

NCBI Entrez ID: 6388
Ensembl gene IDs: ENSG00000132581
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 236250,266120,605899,609560

Library Location

Plate ID: GDExl11004
Well Location: B05

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACGAAACCTCAGGATGGAGCCGGCTCTCTCCTGCTGTTCATCACTCCGTTGCTGCTGCCGGTGATCTTTGCCTCCTAGCTGTCCGTGGTGACCTGCGGCTCAATGGTCAAGTTGCTCATTATCAAGCACAATGTCCGGCTCCCTTCGCATGACATTCGCTACTGTTCAGGCGTCGGACAGCATTCTGTGACAGGCGTCACATCTGTAAACTATGGCTACAGTTACTGGCGTATCCCTGGGCAGACCTCCACTGTATGCGAGAGAGGAACAATGATTAAATGTGGACAATCTATGCGTCTAACACATGTCAACACAGGACGCAATCTGCACAGTCATCACTTCACTTCTCCTCTGTCTGGAAACCAGGAAGTCAGTGCATTTGGGGATGATGGGGAAGGTGACATCCTGGATGACTGGACGGTTCTATGTGATGGATAATTCTGGCATATAGATGATGATGTCCAACTTAGACACACATCCACCAATGTTTTCCTCTCTATCACAGGGGAACAGTACGGGAGGCCCATTATTGAGCAAATGGAAGTTCACTGCATGTCTCATTCTAACCAAATCAGCTGTTGGAAAGTCCTGGAGGGGATATTCATGAATCCAATGAACAGACACGGAGTCCAATGCTCAGACCTGATCAATGGCCACTTTTTTGTACAAAGTTTGCTTATAAGAAAGATTTGCTTATCATTTTGTTGGAACAAACAGGTCCCTAATAGTTCAAAAAAAATTCATTTATTTGGGGTCCCGAATTATTAACCCCCAACGGTGGTTCTTAATCTATCTGTGTGTCCGTGGCTTGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACGAAGCCTCAGGAT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: AAAAAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTTCAATATGACCATTCTGAGTCCGGGACTGCTCGCTTGGCTTCATGAATATCCCCTCCCTGACTTTCCTATACCTGTTTTGGTTAGAATATGACATGCAGTGAACTTCCCTCTGGCCATTAATGGGCCTCCCATACTGTTCCCCTGTGATAGACAGGAAAACATTGGTGGATGTGTGTCTAAGTCGGACATCATCATCTCTTTGCCAGAATTCTCCATCACATAAAAGCGTCCAGTCATCCCGGATGTCACCTTCCCCCTCAACACCAAATGCGATGACTTCCGGGTTTCCTAACCGACGAAAACTGAACTGATGACGGTGCAGATTGCGTCCTGTGTTGACCTGTTTTACACTGCACAGATTGTCCACATTTCATCGTTGTTCCTCTCTAGCATACAGTGGACGTTTGCCCACAGATACCCCAGTAACTGTTGCCATCGTCTACGGATATAACGCCTGTCACAGACTGCTGTCCGCTGCCTGAACCGTATCGAACGTCATGCGAATGGAGCCGGACATTGTGCTTGATATTGAGCAACTTGACCACTGAACCGCATGTCACCACGGACAGCTCGGAGGCAAAGCTCACCCGCAGCGGCAAGTGGATTGAACAACAACAAGAAAAGAGCCAGCCTCCTCCTGAGGCCTCGTCATGGTGCCCAATTTTTTTGTTACAAGTTGGCATTTATAAAAAAACATTTTCTCATCAATTGTTTCGCACCGAACAAGGTCCCTTTTCAGTTGAAAAATAAAATTCCAATTAATTATAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGTTCAGTATGAGCATTCTGAGT