ORFeome > sdha ORF1 – XORFeome v1.0

sdha ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sdha
Gene ID: 956949
Gene Page ID: 956941
ORF Xenbase ID: 17295501

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047261
Original XGC clone length: 1998

Human orthology & disease relationships

NCBI Entrez ID: 6389
Ensembl gene IDs: ENSG00000073578
Directly associated (OMIM) disease MIM numbers: 252011,256000,613642,614165
Indirectly associated (Lage, et al.) disease MIM numbers: 115310,150800,171300,251000,252011,256000,605373,605839,606812

Library Location

Plate ID: GDExl11014
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGAGGCGAACTAGTATAATAAATTTTTTATTATTTATATTAGAAGGTGAATATTGTGTACCTTGTGTTACGCGAAGCATGTATAGGATTGGAGTGAGGCGAATTTTATTGTACTCTATGACCTTCTCTTTCTGTATAGTGCGGAACTCTATGTCTGCGAGACGCACATCAGAGTGGATCGAAGCGCATCGTATCTTGCATCATCATGGGACCCCGTCTTGTGGTAGCCTCGTAGAGGCGATACACTCAAGGGTAAGATATATCACATTATCCACATGACGAGCAACATCGCGACACACACCACTCTCGACCTTCCACACGATTGAGAGCGGTAATAAGTATCCACCTTGTCGTCGCTAGTAGAAGGGCAAGAGGCTACGAGAAGTTTATCTACTACAAATAGTTTCTCAGAGTGTCGTAGTGTTTTCACACCAAAAGATTCAGGGTGAATTCGATCCCACTAAACATTGTGGGNACCAACATAGTGTTGTGTGTGTGACATGGAAGTGATGAGCATGATACAAAAGAGCTAGCAGCTTGTTTGGTGATATCCTCGATAGGTGGGGAGGTTATACAACAGCAAATCGTTTTTGAAGGAGAGCGCGCTGCTCGCTTATATAATAGATTCTGCCACGCGTGGTGACACCCCAACAAGAGGAGGAATATATAATACTCCCCTGCTGGCGCGCTGATCATCAAGTAAGGATTTAAACGAAAAGGCGGCGGGTCCTCATCGGATGGGCCCATTAGAGGGCACTCGCTACGAGAGTGTGGTGGGAGGACACACAATAGATTTCCTCACCATACTCTATTCGCAACAAAAACAACAACCCCCGCCAGGAAAATAACATCGCAGGAAAAAGATGAACTGAGTAGTGCATCTCCTCGCGCAAGGAGCATAAAGCGCGGAAGAAAGAAATACCTGCGGCGGCTCTTATTTTAATAGAAAAAAGGATATTTTATTAATCAGAAATAAGGAGAAGGAGGGACTTCTCCCCTCTGTCATTTTTGTTTTTGTTGTGGAGAAAAAAGAAGACCATCGGCCTGGCTCGTCCCTCCCCCCTCCCTCCTCGAGGGGGGAGGAAGAGGCGTTGGTTAAAAAGAAAGAAGAAACCACCCTAGAAAATACAAAAAGAAACACGGGCGCGCTTCTCCGTATTGTGGAGGAATGGGGTGGAGGGAAAGGTGATAGGGAAGAAGGGCCCCCCCCCTCCCCCACCCCAAAAAACAAAGAGCGCAAAGAGACACCCCCCCCCCCCACCCCCCCTCCCCACACCCACCCACCGGAACACCAACACCACCCCCGCGCGCGCCCCGGCGGGCGCGGGGGGAGAGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTGCTGAAAGTGG

Sequences - 3ʹ (reverse) EST

Accession: JZ829541
dbEST ID: 79647243
Trimmed Sequence: GTAGGAACGAATTGCCGGCGGGACAGATGCACAGTCTTCATTTAAAGTTGCATCGATTACAGGTCTGTATTCCAAGCTAACCTTTCCTTTACTATCAACATATGATAGTGTGTGCTTCCTCCAGTGCTCGCTAAAACTTTTCTTCTGTTGACCTTGAATTGGTTTTGAATAATCATACTCATCAATCCTCGTCTTGTAATCTTCTCTTGCATGGGCACCACGACTTTCTTTGCGTGCCTCAGCACTATTAATTGTTTGCAGTGCACATAGCATTAAGTTTTGTAGCTCTAGTGTCTCCACTACATCAGTGTTCCAAACAATACCTCTATCAAATGTCTTTAAGTCATCCATTGCAGAATTGATGACACTCAGTTTTTCACAACCTTCCTTCAACACAGAACCTGTTCGGAAAACTGCAGCATGAGTCTGCATGGTCTTCTGCATGTTGAGTCTAAGTTCTGAAGTTCTAGTGCTTCCATTAGCAAAGCGTAATTTGTCCAGATTTGCAACGGATTCCTCTCCTGCATTTTCCTTAATTGATGGCAACGCTTCACCAGGCTTGCACTCCTCTGCAATGCTAAGAGCACATGCACGACCAAAGACCACCAGATCCAGAAGAGAGTTTGCGCCCAATCTGTTGGCTCCATGTACTGGAGCAGATGCAGCCTCTCCACNAGCATAAAGCCCTGGGCACACTCTATCTTCACCATTTACTTGGGGTATCC
Full Trace Sequence: TGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTAGGAACGAATTGCCGGCGGGACAGATGCACAGTCTTCATTTAAAGTTGCATCGATTACAGGTCTGTATTCCAAGCTAACCTTTCCTTTACTATCAACATATGATAGTGTGTGCTTCCTCCAGTGCTCGCTAAAACTTTTCTTCTGTTGACCTTGAATTGGTTTTGAATAATCATACTCATCAATCCTCGTCTTGTAATCTTCTCTTGCATGGGCACCACGACTTTCTTTGCGTGCCTCAGCACTATTAATTGTTTGCAGTGCACATAGCATTAAGTTTTGTAGCTCTAGTGTCTCCACTACATCAGTGTTCCAAACAATACCTCTATCAAATGTCTTTAAGTCATCCATTGCAGAATTGATGACACTCAGTTTTTCACAACCTTCCTTCAACACAGAACCTGTTCGGAAAACTGCAGCATGAGTCTGCATGGTCTTCTGCATGTTGAGTCTAAGTTCTGAAGTTCTAGTGCTTCCATTAGCAAAGCGTAATTTGTCCAGATTTGCAACGGATTCCTCTCCTGCATTTTCCTTAATTGATGGCAACGCTTCACCAGGCTTGCACTCCTCTGCAATGCTAAGAGCACATGCACGACCAAAGACCACCAGATCCAGAAGAGAGTTTGCGCCCAATCTGTTGGCTCCATGTACTGGAGCAGATGCAGCCTCTCCACNAGCATAAAGCCCTGGGCACACTCTATCTTCACCATTTACTTGGGGTATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAGGAACGAATTGCCGGCG