ORFeome > sdr42e1 ORF1 – XORFeome v1.0

sdr42e1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sdr42e1
Gene ID: 985968
Gene Page ID: 985964
ORF Xenbase ID: 17295555

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123279
Original XGC clone length: 1161

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11091
Well Location: A12

Sequences - 5ʹ (forward) EST

Accession: JZ838750
dbEST ID: 79656452
Trimmed Sequence: ATGAGCAGTTCACAGCGAGCCAAAGAAACAGTGGTTATAACAGGAGGAGGTGGTTACTTTGGACACAGACTTGGATGTACCTTGCACGAGAAAGGAGTTCATGTAATCCTCTTTGATATACGAAAACCAGACCAAGAGCTGCCTGAAGGAATCCATTTTGTTCAAGGAGACGTGCGTTCTCTCTCTCAGCTGGAAGATGTGGTGGCAGGCGCAAGCTGTGTATTTCATACAGCCTCTTATGGAATGTCTGGGAAGGAGCAACTCCATCGGCAGAAAATTGAAGCTATAAATGTCAGAGGCACAGAGAATATAATCCAAGCTTGCATAAACACAAATGTTCCGAGGCTTGTATACACAAGTACCTTTAATGTGATTTTTGGTGGGCAAACAATAAGAGACGGCGATGAGTCTCTGCCGTATCTACCTCAGGATGCATTCGTAGATAACTACTCCCGCACAAAGACAGTCGCAGAGATGTTTGTACTGAAAATGAATAATCAAGAATTGAAAAATAACAGTGGCTTTCTAAGAACCTGTTCTCTCCGGGCTGCTGGGATCTACGGGCCTGGGGAGCAGCGGACATCTGCCTAAAAATTATTATTGCCCTTGAAAAGGGGAATTTTCTTGTTGTTTACGGGGGATAATCCTCCTGGTCCTTTCGTACATGTCCATATTCTCCAATTCTGCACATATTTTAACAGCTGAAGGCTTGAACCTTCGGAAAAGAAATACTTATGCTTGTGGGGCGACCCCTACTTTTTTTTTCTAACCGCGCCCCCCGAGGAAAAAACTTTTAAATTTTTTGCGGCGCCCTCTCTCGGGGAAAG
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCAGTTCACAGCGAGCCAAAGAAACAGTGGTTATAACAGGAGGAGGTGGTTACTTTGGACACAGACTTGGATGTACCTTGCACGAGAAAGGAGTTCATGTAATCCTCTTTGATATACGAAAACCAGACCAAGAGCTGCCTGAAGGAATCCATTTTGTTCAAGGAGACGTGCGTTCTCTCTCTCAGCTGGAAGATGTGGTGGCAGGCGCAAGCTGTGTATTTCATACAGCCTCTTATGGAATGTCTGGGAAGGAGCAACTCCATCGGCAGAAAATTGAAGCTATAAATGTCAGAGGCACAGAGAATATAATCCAAGCTTGCATAAACACAAATGTTCCGAGGCTTGTATACACAAGTACCTTTAATGTGATTTTTGGTGGGCAAACAATAAGAGACGGCGATGAGTCTCTGCCGTATCTACCTCAGGATGCATTCGTAGATAACTACTCCCGCACAAAGACAGTCGCAGAGATGTTTGTACTGAAAATGAATAATCAAGAATTGAAAAATAACAGTGGCTTTCTAAGAACCTGTTCTCTCCGGGCTGCTGGGATCTACGGGCCTGGGGAGCAGCGGACATCTGCCTAAAAATTATTATTGCCCTTGAAAAGGGGAATTTTCTTGTTGTTTACGGGGGATAATCCTCCTGGTCCTTTCGTACATGTCCATATTCTCCAATTCTGCACATATTTTAACAGCTGAAGGCTTGAACCTTCGGAAAAGAAATACTTATGCTTGTGGGGCGACCCCTACTTTTTTTTTCTAACCGCGCCCCCCGAGGAAAAAACTTTTAAATTTTTTGCGGCGCCCTCTCTCGGGGAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGTTCACAGCGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838749
dbEST ID: 79656451
Trimmed Sequence: TTCACTACTAGGAAGCCATGATAACAGCACGACAGTCACCAATAAAATAAAAATGATGTCCCAAATCAAGTAATTGCTTTTGATCTTCTTGTCCTGTTTGCCGTAGCCATGGTTTTTAAACCATTCAGCCACGTCTTGCATTGTAAATGGCTGCGGTTCAAACCCCAGTTCTCTTGTGGCCTTTTCAATCTTGAAGTAGTGAGTGACCCCCGTTTTGAAAACTTCAGCCCGTGTCAGGATAGGCTGAAAGTCGCACACAGGGCTAATAAAAAAGTGAATCCACTCCGTCAAAAATGCAAAAAAATAAACGAGCGACAGGGGAAAACGAAGGGAAGGGAACTTATAACCAAGGCCTTCCACGAGGGGCCTGAAAAATTCAAAGTTATTCACTGGGGGGCCGTCAGAAATGAAGTAGGGTTGCCCAGCAGCAATGTATTTCTTTTCAGATGTTAAAGCCTCAGCTGCTAAAATATGTGCAGATATGAGATTATCGACATGTACGAACTGAACAAGAGGATTATCCCCGTATACAAACAAGAACATCCCCTTTTCAAGGGCACTAATAATTCTAGGCAGATGTCGCTGCTCCCCANGCCCGTAGATCCCAGCAGCCCGGAAAGAACAGGTTCTTAGAAAGCCCTGTTAATTTTTCAATTCTTGATTATTCATTTTTAAATCCAACATCTTCTCCAACTGTCTTTTGTGCGGGGAATAATTATCCTACCAAAGGCATCCCTGAAGGGATAAATCCGGCAAAAAAAACC
Full Trace Sequence: GGAAAACAGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCACTACTAGGAAGCCATGATAACAGCACGACAGTCACCAATAAAATAAAAATGATGTCCCAAATCAAGTAATTGCTTTTGATCTTCTTGTCCTGTTTGCCGTAGCCATGGTTTTTAAACCATTCAGCCACGTCTTGCATTGTAAATGGCTGCGGTTCAAACCCCAGTTCTCTTGTGGCCTTTTCAATCTTGAAGTAGTGAGTGACCCCCGTTTTGAAAACTTCAGCCCGTGTCAGGATAGGCTGAAAGTCGCACACAGGGCTAATAAAAAAGTGAATCCACTCCGTCAAAAATGCAAAAAAATAAACGAGCGACAGGGGAAAACGAAGGGAAGGGAACTTATAACCAAGGCCTTCCACGAGGGGCCTGAAAAATTCAAAGTTATTCACTGGGGGGCCGTCAGAAATGAAGTAGGGTTGCCCAGCAGCAATGTATTTCTTTTCAGATGTTAAAGCCTCAGCTGCTAAAATATGTGCAGATATGAGATTATCGACATGTACGAACTGAACAAGAGGATTATCCCCGTATACAAACAAGAACATCCCCTTTTCAAGGGCACTAATAATTCTAGGCAGATGTCGCTGCTCCCCANGCCCGTAGATCCCAGCAGCCCGGAAAGAACAGGTTCTTAGAAAGCCCTGTTAATTTTTCAATTCTTGATTATTCATTTTTAAATCCAACATCTTCTCCAACTGTCTTTTGTGCGGGGAATAATTATCCTACCAAAGGCATCCCTGAAGGGATAAATCCGGCAAAAAAAACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCACTACTAGGAAGCCATGAT