ORFeome > sds ORF1 – XORFeome v1.0

sds ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sds
Gene ID: 6255863
Gene Page ID: 921977
ORF Xenbase ID: 17295561

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129680
Original XGC clone length: 987

Human orthology & disease relationships

NCBI Entrez ID: 10993
Ensembl gene IDs: ENSG00000135094
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 217800,219500,229100,236250,250940,259900,600794,601472,605899,606664,608688

Library Location

Plate ID: GDExl11091
Well Location: H03

Sequences - 5ʹ (forward) EST

Accession: JZ838693
dbEST ID: 79656395
Trimmed Sequence: ATGCCAGAGAACAAATGTCTGCATCTCAACACACCTCTCAGAGATAGTGTACCTTTGTCCAAAATGGCTGGAATGACAGTTTACTTGAAGCTTGATAACGCACAGCCAACAGGGTCCTTCAAAATTCGGGGCATTGGTCATCTGTGCAAGACGTGGGCAGAACGGGGCTGTAAACATTTTGTCTGCTCATCAGGAGGAAATGCTGGTCTGGCAGCTGCTTACAGTGCCCGGATGCTCTCCATACCCGCTACTATTCTTGTGCCCAACACTACACCCGCATTTACAATTCAAAGAATGAAAGATGAAGGAGCCACAGTCTGTGTTGTGGGAGAGATGCTGGATGAGACCATTGAGCATGGCAAAGAGCTGGTGAGGAATAACCCAGGATGGGTGTACATCCCCCCATTTGATGACCCACTGATATGGGAGGGTCACACCTCACTGGTAAAAGAAATTAAAGCCAGTCTACCTTCCAAACCTGGCGCCGTTGCCTTGTCCGTGGGAGGTGGAGGCATGCTTTGTGGAGTGGTCCAGGGGCCCAGAGAAAAAAGATGGGATGATGTTCCTATCATTGCTATGGAAAACCAGGAAGCTCCAGTCTCCATGCTGCCCTTCAAGCTGGAAAATTGGTCCCCTTACCAAAAATAACCATTGGAGCTTAAACGCTGGGAAACAAAAACGTAAGAACTCAAACCCAAAAAGTTGCGTAAAAAAATTGAGTGGTTTACAGAAGTTCATTTCCTGAACAAAAAAGACCGTGAATGGCTT
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCAGAGAACAAATGTCTGCATCTCAACACACCTCTCAGAGATAGTGTACCTTTGTCCAAAATGGCTGGAATGACAGTTTACTTGAAGCTTGATAACGCACAGCCAACAGGGTCCTTCAAAATTCGGGGCATTGGTCATCTGTGCAAGACGTGGGCAGAACGGGGCTGTAAACATTTTGTCTGCTCATCAGGAGGAAATGCTGGTCTGGCAGCTGCTTACAGTGCCCGGATGCTCTCCATACCCGCTACTATTCTTGTGCCCAACACTACACCCGCATTTACAATTCAAAGAATGAAAGATGAAGGAGCCACAGTCTGTGTTGTGGGAGAGATGCTGGATGAGACCATTGAGCATGGCAAAGAGCTGGTGAGGAATAACCCAGGATGGGTGTACATCCCCCCATTTGATGACCCACTGATATGGGAGGGTCACACCTCACTGGTAAAAGAAATTAAAGCCAGTCTACCTTCCAAACCTGGCGCCGTTGCCTTGTCCGTGGGAGGTGGAGGCATGCTTTGTGGAGTGGTCCAGGGGCCCAGAGAAAAAAGATGGGATGATGTTCCTATCATTGCTATGGAAAACCAGGAAGCTCCAGTCTCCATGCTGCCCTTCAAGCTGGAAAATTGGTCCCCTTACCAAAAATAACCATTGGAGCTTAAACGCTGGGAAACAAAAACGTAAGAACTCAAACCCAAAAAGTTGCGTAAAAAAATTGAGTGGTTTACAGAAGTTCATTTCCTGAACAAAAAAGACCGTGAATGGCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCAGAGAACAAATGTCTGC

Sequences - 3ʹ (reverse) EST

Accession: JZ838692
dbEST ID: 79656394
Trimmed Sequence: AGCAGAGCTATCGGACAGCATCCCCAGTTGTTTCTTTAGCTGGAAGAGCTGCGCTAGGGTAATATTGTTTCCTCCACAAACAATGATGACCAGAGAGGAGAGATCTGGGCTCAATTTTCCTTCTTTTTTCAGTCTTTCTGCAACATTGCTGTAAACTGCAGCTAAAGCAGCACCACAGGCAGGCTCCACTAACATCTTCTCATCATCTGCAAACTTCTCAATAGCCATCACGGCCTCTTGGTCAGAAATGACCTCTGAAAACACTGAATGTTCTTGAGCAACTTTTAGGGTCTGAGCTCCTACAGTTTTGGCTCCCAGCGTTTTAGCTACACTGGTTATTTCTGGTAAGGTGACCAATTTTCCAGCTTGAAGGGCAGCATTGAGACTGTGAGCTCCCTTGGTTTCCATAACAATGATAGGAACATCATCCCATCCTTCTTCTCTGAGCCCCTGGACCACTCCCACAAGCATGCCTCCACCTCCCACGGACAAGGCAATGGCGCCAGGTTTGGAAGGTAGACTGGCTTTAATTTCTTTTACCAGTGAAGGTGGGAGCCGCCCTAACAGTGGGTCGTGCAAGTGGGGGGAGGGGGAGCCATCCTGGGTTATGCGTCACCACCCTCTCTGCCATGCTCGTGGGGCGTCGGCGGCCATCTCCTCCACAACCCAGAAGCGGGGGCGCCGTGCGTCTTTCCATTCCCTTTAATTTGAAATTGCGGGGGTGGTGGGTTGTGGGGGGGGGGAGGAGGGGGTAAGCCAAAATAAGTAAAGAAAAAGACGGGG
Full Trace Sequence: GAAACGTCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGCAGAGCTATCGGACAGCATCCCCAGTTGTTTCTTTAGCTGGAAGAGCTGCGCTAGGGTAATATTGTTTCCTCCACAAACAATGATGACCAGAGAGGAGAGATCTGGGCTCAATTTTCCTTCTTTTTTCAGTCTTTCTGCAACATTGCTGTAAACTGCAGCTAAAGCAGCACCACAGGCAGGCTCCACTAACATCTTCTCATCATCTGCAAACTTCTCAATAGCCATCACGGCCTCTTGGTCAGAAATGACCTCTGAAAACACTGAATGTTCTTGAGCAACTTTTAGGGTCTGAGCTCCTACAGTTTTGGCTCCCAGCGTTTTAGCTACACTGGTTATTTCTGGTAAGGTGACCAATTTTCCAGCTTGAAGGGCAGCATTGAGACTGTGAGCTCCCTTGGTTTCCATAACAATGATAGGAACATCATCCCATCCTTCTTCTCTGAGCCCCTGGACCACTCCCACAAGCATGCCTCCACCTCCCACGGACAAGGCAATGGCGCCAGGTTTGGAAGGTAGACTGGCTTTAATTTCTTTTACCAGTGAAGGTGGGAGCCGCCCTAACAGTGGGTCGTGCAAGTGGGGGGAGGGGGAGCCATCCTGGGTTATGCGTCACCACCCTCTCTGCCATGCTCGTGGGGCGTCGGCGGCCATCTCCTCCACAACCCAGAAGCGGGGGCGCCGTGCGTCTTTCCATTCCCTTTAATTTGAAATTGCGGGGGTGGTGGGTTGTGGGGGGGGGGAGGAGGGGGTAAGCCAAAATAAGTAAAGAAAAAGACGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGCAGAGCTATCGGACAGCA