ORFeome > sec11a ORF1 – XORFeome v1.0

sec11a ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sec11a
Gene ID: 943213
Gene Page ID: 943207
ORF Xenbase ID: 17295573

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054167
Original XGC clone length: 540

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: C04

Sequences - 5ʹ (forward) EST

Accession: JZ839134
dbEST ID: 79656836
Trimmed Sequence: ATGATGTCTATGGATTTTTTAGACGATGTCAGGAGAATGAATAAAAGACAGCTGTACTATCAGGTCTTAAATTTTGGTATGATCGTGTCTTCAGCTCTGATGATATGGAAGGGTCTGATGGTGATTACTGGTAGTGAAAGCCCTATTGTGGTTGTCCTGAGTGGCAGCATGGAGCCGGCATTCCATCGTGGGGACTTGCTTTTCTTGACCAACCGTGTAGATGACCCTATCAGGGTAGGGGAAATTGTGGTCTTTAGGATAGAAGGAAGAGAAATACCCATTGTACATCGTGTCCTAAAGATCCATGAAAAGGAAAACGGAGATATTAAGTTTCTGACCAAGGGGGACAACAATGCAGTGGATGACCGAGGCTTGTACAAACAGGGGCAGAACTGGTTGGAGAAAAAAGATGTAGTGGGACGAGCCCGAGGATTTGTTCCTTATATTGGAATTGTAACCATCCTGATGAACGATTATCCAAAATTTAAGTATGCCGTTCTGTTCCTCTTAGGCTTATTTGTCCTTGTACATCGGGAATT
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGATGTCTATGGATTTTTTAGACGATGTCAGGAGAATGAATAAAAGACAGCTGTACTATCAGGTCTTAAATTTTGGTATGATCGTGTCTTCAGCTCTGATGATATGGAAGGGTCTGATGGTGATTACTGGTAGTGAAAGCCCTATTGTGGTTGTCCTGAGTGGCAGCATGGAGCCGGCATTCCATCGTGGGGACTTGCTTTTCTTGACCAACCGTGTAGATGACCCTATCAGGGTAGGGGAAATTGTGGTCTTTAGGATAGAAGGAAGAGAAATACCCATTGTACATCGTGTCCTAAAGATCCATGAAAAGGAAAACGGAGATATTAAGTTTCTGACCAAGGGGGACAACAATGCAGTGGATGACCGAGGCTTGTACAAACAGGGGCAGAACTGGTTGGAGAAAAAAGATGTAGTGGGACGAGCCCGAGGATTTGTTCCTTATATTGGAATTGTAACCATCCTGATGAACGATTATCCAAAATTTAAGTATGCCGTTCTGTTCCTCTTAGGCTTATTTGTCCTTGTACATCGGGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGGTTATCACTTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAAACATTATTTGCCATCAACCTGAAATCCCCTATATTGATTCGTAATAACATGGGTCAAGCTGGGTTCCTGGCAAAAAAAAAAAAAAAAACAAAAAAAACCAAAAAATAAAAAAAAAAAAAAAAAAAAAGGAAGGNGGGATCACGNTGTCTATGATTAGTTATGTAGGTGGTATATCAACGCTTGTTGTGGGGGGGGAGGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATGTCTATGGATTTTTTAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839133
dbEST ID: 79656835
Trimmed Sequence: TTCCCGATGTACAAGGACAAATAAGCCTAAGAGGAACAGAACGGCATACTTAAATTTTGGATAATCGTTCATCAGGATGGTTACAATTCCAATATAAGGAACAAATCCTCGGGCTCGTCCCACTACATCTTTTTTCTCCAACCAGTTCTGCCCCTGTTTGTACAAGCCTCGGTCATCCACTGCATTGTTGTCCCCCTTGGTCAGAAACTTAATATCTCCGTTTTCCTTTTCATGGATCTTTAGGACACGATGTACAATGGGTATTTCTCTTCCTTCTATCCTAAAGACCACAATTTCCCCTACCCTGATAGGGTCATCTACACGGTTGGTCAAGAAAAGCAAGTCCCCACGATGGAATGCCGGCTCCATGCTGCCACTCAGGACAACCACAATAGGGCTTTCACTACCAGTAATCACCATCAGACCCTTCCATATCATCAGAGCTGAAGACACGATCATACCAAAATTTAAGACCTGATAGTACAGCTGTCTTTTATTCATTCTCCTGACATCGTCCAAAAAATCCATAGACATCATGG
Full Trace Sequence: CAGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCCCGATGTACAAGGACAAATAAGCCTAAGAGGAACAGAACGGCATACTTAAATTTTGGATAATCGTTCATCAGGATGGTTACAATTCCAATATAAGGAACAAATCCTCGGGCTCGTCCCACTACATCTTTTTTCTCCAACCAGTTCTGCCCCTGTTTGTACAAGCCTCGGTCATCCACTGCATTGTTGTCCCCCTTGGTCAGAAACTTAATATCTCCGTTTTCCTTTTCATGGATCTTTAGGACACGATGTACAATGGGTATTTCTCTTCCTTCTATCCTAAAGACCACAATTTCCCCTACCCTGATAGGGTCATCTACACGGTTGGTCAAGAAAAGCAAGTCCCCACGATGGAATGCCGGCTCCATGCTGCCACTCAGGACAACCACAATAGGGCTTTCACTACCAGTAATCACCATCAGACCCTTCCATATCATCAGAGCTGAAGACACGATCATACCAAAATTTAAGACCTGATAGTACAGCTGTCTTTTATTCATTCTCCTGACATCGTCCAAAAAATCCATAGACATCATGGTGCCAACTTTTTTGTACAAGTTGGCATTATAAAAAAGCAATGCTCAACAATTTGTTGCCACGAACAAGTCACTATCAGTCCAAATAAAAATCATTATTTGCGGCCCGAGCCTTAGAATGGACCGTCAGTTTCACCGCCCGGGGACTGGGGAAGATACCCGNCCAACCCTGGGCCCGGTTATCTCCAAATTTCAGGAATGGTTACAAAAAGAANNCNNNNNNCANTGTTTAATNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCCGATGTACAAGGACAA