ORFeome > sec13 ORF1 – XORFeome v1.0

sec13 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sec13
Gene ID: 944458
Gene Page ID: 944451
ORF Xenbase ID: 17295585

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC043755
Original XGC clone length: 963

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11011
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ823839
dbEST ID: 79641541
Trimmed Sequence: ATGGTGTCCGTCATAAACACTGTGGACACTTCCCATGAGGATATGATTCATGATGCCCAGATGGATTATTATGGCATACGTCTTGCTACTTGTTCCTCTGATCGATCTGTGAAGATCTTTGATGTAAAGAATGGAGGCCAGATCCTGATAGCTGACCTGCGTGGGCATGACGGTCCAGTTTGGCAGGTTGCTTGGGCCCATCCCATGTATGGAAACATCTTGGCCTCCTGCTCCTACGACCGGAAAGTAATCATCTGGAAAGAGGAAAATGGGACTTGGGAGAAGACGTATGAATACACAGGGCACGACTCTTCAGTAAATTCTGTTTGCTGGGCTCCCCACGACTTCGGGCTAGTGCTGGCATGTGGCAGTTCGGATGGAGCGATCTCTATTCTCACTTTTACCGGAGACGGGCCCTGGGAAGTGAAAAAAATCAGCAACGCACACACAATTGGTTGTAACGCAGTGAGCTGGGCCCCTTCTGTTATCCCTGGAAGTCTTGTTGATCAGCCATCCAGTCAGAAGCCCAATTATATCAAGAGATTTGTGTCTGGCGGATGTGATAACTTAGTGAAAATCTGGAGGGAGGAAGATGGCCAGTGGAAAGAGGATCAGAAGCTGGAAGCTCACAGTGATTGCGTGCGGGATGTGGCCTGTGCTCCCTCCATTGGTTTGCCAACCAGCACCATCGCTAGTTGCTCTCAGGATGGCCGGGTATATATCTGGGACAAGTGATGATGCTTCCCACCCACTGTTGGGACTCCCCAAACTGC
Full Trace Sequence: AAATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTGTCCGTCATAAACACTGTGGACACTTCCCATGAGGATATGATTCATGATGCCCAGATGGATTATTATGGCATACGTCTTGCTACTTGTTCCTCTGATCGATCTGTGAAGATCTTTGATGTAAAGAATGGAGGCCAGATCCTGATAGCTGACCTGCGTGGGCATGACGGTCCAGTTTGGCAGGTTGCTTGGGCCCATCCCATGTATGGAAACATCTTGGCCTCCTGCTCCTACGACCGGAAAGTAATCATCTGGAAAGAGGAAAATGGGACTTGGGAGAAGACGTATGAATACACAGGGCACGACTCTTCAGTAAATTCTGTTTGCTGGGCTCCCCACGACTTCGGGCTAGTGCTGGCATGTGGCAGTTCGGATGGAGCGATCTCTATTCTCACTTTTACCGGAGACGGGCCCTGGGAAGTGAAAAAAATCAGCAACGCACACACAATTGGTTGTAACGCAGTGAGCTGGGCCCCTTCTGTTATCCCTGGAAGTCTTGTTGATCAGCCATCCAGTCAGAAGCCCAATTATATCAAGAGATTTGTGTCTGGCGGATGTGATAACTTAGTGAAAATCTGGAGGGAGGAAGATGGCCAGTGGAAAGAGGATCAGAAGCTGGAAGCTCACAGTGATTGCGTGCGGGATGTGGCCTGTGCTCCCTCCATTGGTTTGCCAACCAGCACCATCGCTAGTTGCTCTCAGGATGGCCGGGTATATATCTGGGACAAGTGATGATGCTTCCCACCCACTGTTGGGACTCCCCAAACTGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTCCGTCATAAACACT

Sequences - 3ʹ (reverse) EST

Accession: JZ829147
dbEST ID: 79646849
Trimmed Sequence: TTGGTCATTTAATTGTCCCTCTGTCACGGTGGAAACAGCTCCTTGTCCCTTGTTTACATCACTAATACAGGCCCACTGTCCATCCACAGACTCCTTCCATAAGGTCACCTTGTTGTCACCCCCAGACACAGCCAGGATATTAGCAGTGATGGACCAGCTCACATGCCAAACAACATCATTAAACTTGTGCAGCAGTTTCGGAGTCCAACAGTTGGTGGCAGCATCATCACTTGTCCAGATATATACCCGGCCATCCTGAGAGCAACTAGCGATGGTGCTGGTTGGCAAACCAATGGAGGGAGCCCAGGCCACATCCCGCACCCAATCACTGTGAGCTTCCAGCTTCTGATCCTCTTTCCACTGGCCATCTTCCTCCCTCCAGATTTTCACTAAGTTATCACATCCGCCAGACACAAATCTCTTGATATAATTGGGCTTCTGACTGGATGGCTGATCAACAAGACTTCCAGGGATAACAGAAGGGGCCCAGCTCACTGCGTTACAACCAATTGTGTGTGCGTTGCTGATTTTTTTCACTTCCCAGGGCCCGTCTCCGGTAAAAGTGAGAATAGAGATCGCTCCATCCGAACTGCCACATGCCAGCACTAGGCCCGAAGTCGTGGGGAGCCCCAACAACAGAAGTTACCTGAAGAGTCGTGCCCTGTGTATTCCTACGTCTTTCTCCCAAGTCCCAATTTTCCTTCTTTCCCAAATGATTAACTTTTCCGGTTCGTAGGGACCAGGAAAGGCCCAAAAAAGGTTTTCCCCTAC
Full Trace Sequence: TGCCGGGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTGGTCATTTAATTGTCCCTCTGTCACGGTGGAAACAGCTCCTTGTCCCTTGTTTACATCACTAATACAGGCCCACTGTCCATCCACAGACTCCTTCCATAAGGTCACCTTGTTGTCACCCCCAGACACAGCCAGGATATTAGCAGTGATGGACCAGCTCACATGCCAAACAACATCATTAAACTTGTGCAGCAGTTTCGGAGTCCAACAGTTGGTGGCAGCATCATCACTTGTCCAGATATATACCCGGCCATCCTGAGAGCAACTAGCGATGGTGCTGGTTGGCAAACCAATGGAGGGAGCCCAGGCCACATCCCGCACCCAATCACTGTGAGCTTCCAGCTTCTGATCCTCTTTCCACTGGCCATCTTCCTCCCTCCAGATTTTCACTAAGTTATCACATCCGCCAGACACAAATCTCTTGATATAATTGGGCTTCTGACTGGATGGCTGATCAACAAGACTTCCAGGGATAACAGAAGGGGCCCAGCTCACTGCGTTACAACCAATTGTGTGTGCGTTGCTGATTTTTTTCACTTCCCAGGGCCCGTCTCCGGTAAAAGTGAGAATAGAGATCGCTCCATCCGAACTGCCACATGCCAGCACTAGGCCCGAAGTCGTGGGGAGCCCCAACAACAGAAGTTACCTGAAGAGTCGTGCCCTGTGTATTCCTACGTCTTTCTCCCAAGTCCCAATTTTCCTTCTTTCCCAAATGATTAACTTTTCCGGTTCGTAGGGACCAGGAAAGGCCCAAAAAAGGTTTTCCCCTAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTGGTCATTTAATTGTCCCTCTGT