ORFeome > sec22b ORF1 – XORFeome v1.0

sec22b ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sec22b
Gene ID: 999426
Gene Page ID: 999420
ORF Xenbase ID: 17295633

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054298
Original XGC clone length: 663

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11002
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ839425
dbEST ID: 79657127
Trimmed Sequence: ATGGTCCTGCTAACGATGATCGCCCGAGTGGCGGACGGACTCCCGCTGGCAGCCTCTATGCAGGAGAACGAACAGGTGAAATGTTCATATGCAGGCAGAGACCTGCAGCAGTACCAGAACCAGGCCAAGCAGTTGTTCCGCAAGCTGAATGAACAGTCTCCAACGCGATGCACCCTGGAGGCAGGAGCCATGAGCTTTCACTACCTGATTGAGAAAGGCGTTTGTTATCTGGTTCTCTGTGAAGCTGCTTTCCCCAAGAAGCTGGCCTTTGCTTATCTGGAAGATCTGTATTCGGAATTTGACGAACAACATGGGAAGAAAGTGCCAACGGTCTCACGGCCATACTCCTTTATAGAGTTCGATAACTACATCCAGAAGACAAAGAAGTCATACATTGACAGCCGAGCCAGAAGAAACCTTAGTTCTGTAAACACTGAGCTGCAGGATGTGCAGAGGATCATGGTTGCTAATATTGAAGAAGTTTTGCAACGGGGAGAAGCACTTTCAGCTTTGGATTCAAAGGCCAACAACCTATCAACCTTGTCTAAGAAGTACCGTCAAGACGCAAAGTACCTGAACATGCGCTCCACTTACGCCCAGCTGGCCGCTGTTGCAGTGTTCTCCATCATGTTCATTGTGTATATTCAATTCTGGGTGGTTTGTTGGCCACTTTTCTTGTACATGGTTGGCATTTATAAGAAAGCATTG
Full Trace Sequence: GGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTCCTGCTAACGATGATCGCCCGAGTGGCGGACGGACTCCCGCTGGCAGCCTCTATGCAGGAGAACGAACAGGTGAAATGTTCATATGCAGGCAGAGACCTGCAGCAGTACCAGAACCAGGCCAAGCAGTTGTTCCGCAAGCTGAATGAACAGTCTCCAACGCGATGCACCCTGGAGGCAGGAGCCATGAGCTTTCACTACCTGATTGAGAAAGGCGTTTGTTATCTGGTTCTCTGTGAAGCTGCTTTCCCCAAGAAGCTGGCCTTTGCTTATCTGGAAGATCTGTATTCGGAATTTGACGAACAACATGGGAAGAAAGTGCCAACGGTCTCACGGCCATACTCCTTTATAGAGTTCGATAACTACATCCAGAAGACAAAGAAGTCATACATTGACAGCCGAGCCAGAAGAAACCTTAGTTCTGTAAACACTGAGCTGCAGGATGTGCAGAGGATCATGGTTGCTAATATTGAAGAAGTTTTGCAACGGGGAGAAGCACTTTCAGCTTTGGATTCAAAGGCCAACAACCTATCAACCTTGTCTAAGAAGTACCGTCAAGACGCAAAGTACCTGAACATGCGCTCCACTTACGCCCAGCTGGCCGCTGTTGCAGTGTTCTCCATCATGTTCATTGTGTATATTCAATTCTGGGTGGTTTGTTGGCCACTTTTCTTGTACATGGTTGGCATTTATAAGAAAGCATTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTCCTGCTAACGATG

Sequences - 3ʹ (reverse) EST

Accession: JZ839424
dbEST ID: 79657126
Trimmed Sequence: CAACCACCAGAATCGAATATACACAATGAACATGATGGAGAACACTGCTACAGCGGCCAGCTTGGCGTAAGTGGAGCGCATGTTCAGGTACTTTGCGTCTTGACGGTACTTCTTAGACAAGGTTGATAGGTTGTTGGCCTTTGAATCCAAAGCTGAAAGTGCTTCTCCCCGTTGCAAAACTTCTTCAATATTAGCAACCATGATCCTCTGCACATCCTGCAGCTCAGTGTTTACAGAACTAAGGTTTCTTCTGGCTCGGCTGTCAATGTATGACTTCTTTGTCTTCTGGATGTAGTTATCGAACTCTATAAAGGAGTATGGCCGTGAGACCGTTGGCACTTTCTTCCCATGTTGTTCGTCAAATTCCGAATACAGATCTTCCAGATAAGCAAAGGCCAGCTTCTTGGGGAAAGCAGCTTCACAGAGAACCAGATAACAAACGCCTTTCTCAATCAGGTAGTGAAAGCTCATGGCTCCTGCCTCCAGGGTGCATCGCGTTGGAGACTGTTCATTCATCTTGCGGAACAACTGCTTGGCCTGGTTCTGGTACTGCTGCAGGTCTCTGCCTGCATATGAACATTTTCACTGTTCGTTCTCCTGCTAAAAAGCGCCCAGCGGGATTCCTTCCGCCCCTCGGGCAATAATCATTAACAAAAACATGGGGCCAACTTTTTTTGTACAAATTGGGCATTGGGGAAGAACATTTGCCCAAAAAAA
Full Trace Sequence: AAAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAACCACCAGAATCGAATATACACAATGAACATGATGGAGAACACTGCTACAGCGGCCAGCTTGGCGTAAGTGGAGCGCATGTTCAGGTACTTTGCGTCTTGACGGTACTTCTTAGACAAGGTTGATAGGTTGTTGGCCTTTGAATCCAAAGCTGAAAGTGCTTCTCCCCGTTGCAAAACTTCTTCAATATTAGCAACCATGATCCTCTGCACATCCTGCAGCTCAGTGTTTACAGAACTAAGGTTTCTTCTGGCTCGGCTGTCAATGTATGACTTCTTTGTCTTCTGGATGTAGTTATCGAACTCTATAAAGGAGTATGGCCGTGAGACCGTTGGCACTTTCTTCCCATGTTGTTCGTCAAATTCCGAATACAGATCTTCCAGATAAGCAAAGGCCAGCTTCTTGGGGAAAGCAGCTTCACAGAGAACCAGATAACAAACGCCTTTCTCAATCAGGTAGTGAAAGCTCATGGCTCCTGCCTCCAGGGTGCATCGCGTTGGAGACTGTTCATTCATCTTGCGGAACAACTGCTTGGCCTGGTTCTGGTACTGCTGCAGGTCTCTGCCTGCATATGAACATTTTCACTGTTCGTTCTCCTGCTAAAAAGCGCCCAGCGGGATTCCTTCCGCCCCTCGGGCAATAATCATTAACAAAAACATGGGGCCAACTTTTTTTGTACAAATTGGGCATTGGGGAAGAACATTTGCCCAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAACCACCAGAATCGAATATACA