ORFeome > sec23ip ORF1 – XORFeome v1.0

sec23ip ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sec23ip
Gene ID: 969269
Gene Page ID: 969265
ORF Xenbase ID: 17295657

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129630
Original XGC clone length: 2985

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11086
Well Location: B04

Sequences - 5ʹ (forward) EST

Accession: JZ837797
dbEST ID: 79655499
Trimmed Sequence: ATGGCGGGGAAGGTACCGAACGGGGCTCAGTCCGGGCAGCCCGGTAACAACCTTCTCTTCTCCGCCTCTGAAATCAGTTTCTCTCTTCCCTTTATGCCTGTCAGTCAGCAGCAGCAGCCGCTCCACTT
Full Trace Sequence: GCTCGGGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCNTTGCACAAATTGATGAACAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGAAGGTACCGAACGGGGCTCAGTCCGGGCAGCCCGGTAACAACCTTCTCTTCTCCGCCTCTGAAATCAGTTTCTCTCTTCCCTTTATGCCTGTCAGTCAGCAGCAGCAGCCGCTCCACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCGACTGATATCCCCTATAGTGAGTCGTATTACCTGGTTATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCTGAAAAAAACAAAAAACAAAAAATTCCCTATAGCTTGGTAAGAGCAAGCCTGCAATAAACCAGCGGCGTCCTAGTGACCCGGGTTCTCGGTTAACCACTGTTGGGGGGTGACAACTTCCTAAAAAAGGGAAGAACGCCCGGAGACGATTTGAAAATTGTAAGGACAGGTCGTAGCGGTGATGCCAGGGATGTAAAATTTTACAAAAATAGTGGAGTACTTGAATCAAGGAGTTGTGGGGTAGGGATCAATTGGGTTTTTTGGGGCACCGTAAGCCCGTTTCATAAGGAGAATTAGTTTTTGCTCTCGGGGATTAAATATAGATGTTGGGATTACCACGTGTTGTCGAAATAGCGAGCAGGAGATAAAGTGAATGTAATTTAAATTAGCTGGGTGGGGTATGCGTTATATGCAAAGAATTGTTAGAATAGGGAAAGGAGAAGCCTGAAGTGAAATGACCACGATATATCCTGCAGTTGATGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGGGAAGGTACCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837796
dbEST ID: 79655498
Trimmed Sequence: GTGGAGCGGCTGCTGCTGCTGACTGACAGGCATAAAGGGAAGAGAGAAACTGATTTCAGAGGCGGAGAAGAGAAGGTTGTTACCGGGCTGCCCGGACTGAGCCCCGTTCGGTACCTTCCCCGCCATGG
Full Trace Sequence: GGGCCAGGAAACAGCCAATGAACCATGTAATACGACTCACTACTAGGGGAAACCAGCCTGGATGGCAAAAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGAGCGGCTGCTGCTGCTGACTGACAGGCATAAAGGGAAGAGAGAAACTGATTTCAGAGGCGGAGAAGAGAAGGTTGTTACCGGGCTGCCCGGACTGAGCCCCGTTCGGTACCTTCCCCGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGAGGCCCGACCTTAATACTGGCCGTCGTTTTGGAAAAATGAAATAAGAAAATTCCTCCTGAGGGGGGCTTATGGCGGGAACTGGGGAAAAGCCAGGGGGGAATCACAACAAAGGGCTGACCCGGAAAACGGGCCCTGGGATTAAAGAGGTCGTTGATCGGAAGAAATTCACCAGGGTAGGTATAATACGGGGGAAGGGGAATTAAAAGGGGGTGACACAAGGGTCCTGAACGTGGAAATAGATCCAAAGAGGGGAACCGACNGGGGGGGGGGTTTACGGGGGGTGTGTCATATTTTCTGGGGGAGTAATGACACAACGGGGGGGCGCCCNGGAGAAGGGGGCCGGCACGGGGGGGAGAAGGGAGGAAAGGNNAAGAAAANAAANNGTGGAGGANNNNGANNNNCCCNNTAGANNGNNNNCGGNAGNATGGAGAGGAGNNGNGAGAGGNNNNNNNGCGAGGGGGNNGGGGGGGNTANNNGNNNANNNNNGNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNGNNNNGNNNNGNNAGNNNNNNANGANNNNNNNNNNNNNNNNNNNNNGGNNNNGNNNNNNNNGAAGGNNNNNNNNNNNANGNGNNNNGNNNGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNGNNGNNNNNNNNNNGGNNNNNGGNNNNNGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGNGNGNNNNNNNNNNGNNNNNNNGNNNNGNNNNNNNNNNGGNNNNNGNNNNNNNNNNNNNNNNNNNNNGGNNNNNNGNNNNGNNGGNNGNNNNNGGGGNNNNNNGNNNNNNNNNNNNNNNNNNNNNGGNANNGNNNNNGGNNNNNNNNNNNNNNNNNNGNNNNNGNNNGGNNNNNNNNNNNGNGNNNGGNNNNNNNNNNNNNNNGNNNNNNNN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGAGCGGCTGCTCAGG