ORFeome > sec63 ORF1 – XORFeome v1.0

sec63 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sec63
Gene ID: 989525
Gene Page ID: 989520
ORF Xenbase ID: 17295693

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC110927
Original XGC clone length: 2265

Human orthology & disease relationships

NCBI Entrez ID: 11231
Ensembl gene IDs: ENSG00000025796
Directly associated (OMIM) disease MIM numbers: 174050
Indirectly associated (Lage, et al.) disease MIM numbers: 174050,180300

Library Location

Plate ID: GDExl11085
Well Location: G03

Sequences - 5ʹ (forward) EST

Accession: JZ837732
dbEST ID: 79655434
Trimmed Sequence: ATGGCCGGGCAGCAGTTCCAGTATGACGACAGTGGAAACACGTTCTTTTACTTCCTGACTTCTTTCGTGGGGCTCATCGTCATCCCGGCTACATATTACCTGTGGCCACAGGACAAGAACTCTGAGCAAGCTCGTCTGAAAAATATAAGACATGTCTATAGAAGCTGTTCGTGGTACCAGCTTATATTAGTCAAGCCACACAATAATATAGTTCCCACTATAAAAAAAATCATTTTGCTTCTGGGATGGGTCTTATTTCTTTTTCTTGCCTACAAAGTTTCCAAAACTGACAGAGAATATCAGGAGTACAACCCATATGAAGTGTTAGGTTTGGATGCATGGGCAACTGTCTCACAAATCAAGAAACAATATCGTCGTCTGTCTCTTAAATTTCATCCATATAAAGGAGAAGATGATGAAAATGATGATGATTTACCATCTTTATTGTACACAATTCGAATTATAACAATCCCTTGCTGATGACTTTGTTGCGGCGAACAAGTAACTATCAGACAAAAAAAAATCTGTATATGCCAACCAGCTTAAAAACCATAAAGAAAATCATATTTCATCATCATACCTGTTTCCTGACAAAGAAACAAGAATACTACATCTCAAAAGATTGAAAGCAACATGTCAATTTCTAACAAAAAATGTCTTTCTTCAGAAACTGGCGAAACTCCGGATCCGCAAAAAAAAAAAAAAAAACGAGAGAAGAGAAAAATAAGCGGGGGCCCGTTC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCGGGCAGCAGTTCCAGTATGACGACAGTGGAAACACGTTCTTTTACTTCCTGACTTCTTTCGTGGGGCTCATCGTCATCCCGGCTACATATTACCTGTGGCCACAGGACAAGAACTCTGAGCAAGCTCGTCTGAAAAATATAAGACATGTCTATAGAAGCTGTTCGTGGTACCAGCTTATATTAGTCAAGCCACACAATAATATAGTTCCCACTATAAAAAAAATCATTTTGCTTCTGGGATGGGTCTTATTTCTTTTTCTTGCCTACAAAGTTTCCAAAACTGACAGAGAATATCAGGAGTACAACCCATATGAAGTGTTAGGTTTGGATGCATGGGCAACTGTCTCACAAATCAAGAAACAATATCGTCGTCTGTCTCTTAAATTTCATCCATATAAAGGAGAAGATGATGAAAATGATGATGATTTACCATCTTTATTGTACACAATTCGAATTATAACAATCCCTTGCTGATGACTTTGTTGCGGCGAACAAGTAACTATCAGACAAAAAAAAATCTGTATATGCCAACCAGCTTAAAAACCATAAAGAAAATCATATTTCATCATCATACCTGTTTCCTGACAAAGAAACAAGAATACTACATCTCAAAAGATTGAAAGCAACATGTCAATTTCTAACAAAAAATGTCTTTCTTCAGAAACTGGCGAAACTCCGGATCCGCAAAAAAAAAAAAAAAAACGAGAGAAGAGAAAAATAAGCGGGGGCCCGTTC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGGCAGCAGTT

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGCAGAGGAACAGCCACTGAAGAAGGTAAAACGAACCACTATACGGGGAAAACAGCCAGGAGGGCAAAAAAGAGTAAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCATCCTCATCTTCATCATCTTCCTCATCATATCTTTCATCATAGCCATCACTGTCTCCATGATCATCATCCCCTTCTAANATGGTGTCCCACTGTGGATGATTTTCTGGGACTGGTTTGTCTTCCTGAACATCTTCCTTCTATGGTTTTATCTGATTGAAACCCATATAAAAATCTAACATTAATAACACAGGATATAGAAAATTTCCTGGTTTGTTAACTATTTTCATCTTAGGCTCCACCTCTTTTTGCTCCTACAATGAACACATATGATAGGGCTGACATATAAATGTTTGAGTCATTTTGCTCTGAAATGTAGATCCGCGGCCACACATGTTATACCTCTGGAATGAAAATAATGTAAACTAGATAAGTTATCATTGATTTGATTTGATTCCATGGTCATCTATAGACAAAGCATATTGTTGCTGGATGAGCCTTTTTTGATACAATTTGGTGTTATCACACACCATAGCTACTCTGTTATGTATGAACAAACAGGTCATTATCAGTCAGAATATAATCATTATTTGTGGGCCTAGCTAAAACGAAACAGCATTATAGACTTCATCAAACAGATCAGTACAATTCGAGCTATAATAAAGGGATGGGTCGTGAAATTTAAACGGGCAAAAAATAAAAATCACAAAAATGAGATCATTATGTAAAGACGAAACTTCATACTTGACATAGATAACGACGCGGGAACAGAGGAGGGGCGGTATAAAAAAAGTAGGGATGGAAAGGAGGGGGGGCGAGGGGTTAATGACAGGAGAAGGTGAGATCAATCATAAAAAAAAATAAAAGGAGGACGAAAAAAAGGACTAACCGTGGTTCTAAAAAAGGGAAGAGGGAGAAAAAAAAAAAAGAAAGAGAAATAGGAAAGGAGGGAGATGTGAGGAGAGAGGAGGGCAAGAAAGAGAAGGGAGGGGGAAAGAATGGGGGNCGGGGGGAGGGGGGGCGAGAGGAAAGAGAAGAAAGAAGAGGAAAAAAGAGAAGCGAGGGAGCGAGGGAGGGACGGGCGAAAAGGAAAAGAAAGAGAGAAAAAAAGAGAAGGAAGGCGAGGGAGGAGAAAGAGAAGGAAAGAGAAGGAAGAAAAAAGGAAAAAGAGAAAAGAAAAGAAGAAAGAGAGAAAAAAGGAGGGAGGGAAAAAGAGAAAAAAGAGGGAAGAGAACAAGAGGGCTGACAAGAAAGGGGNTAGGTAAGNGAACGGAGAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCATCCTCATCTTCATCATCTTC