ORFeome > seh1l ORF1 – XORFeome v1.0

seh1l ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: seh1l
Gene ID: 1015667
Gene Page ID: 1015660
ORF Xenbase ID: 17295705

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099027
Original XGC clone length: 1083

Human orthology & disease relationships

NCBI Entrez ID: 81929
Ensembl gene IDs: ENSG00000085415
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 188550,231550,609192

Library Location

Plate ID: GDExl11090
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ838447
dbEST ID: 79656149
Trimmed Sequence: ATGTTTGTTGCACGAAGCATCGCTGCCGATCACAAAGATCTCATCCACGATGTGGCCTTTCAATTTCCAGGGCAGGAGGATGGCGACATGTTCCAGCGACCAGAGTGTGAAAGTTTGGGACAAAAGTGAAAATGGCAATTGGCATTGTACTGCGAGTTGGAAGACTCACAGTGGTTCAGTGTGGCGGGTTACATGGGCTCACCCAGAATTTGGCCAGGTATTAGCGTCTTGCTCGTTTGACAGAACTGCTGCAGTGTGGGAAGAAATAGTTGGTGAATCAAATGATAAACTACGTGGACAGAGTCATTGGGTTAAAAGAACAACACTAGTGGACAGCAGAACTTCTGTTACCGATGTAAAGTTTGCTCCAAAACACATGGGCCTGATGTTGGCGACCTGCTCTGCAGATGGAGTGGTGAGAATATATGAGGCCCCTGATGTTATGAACCTCAGCCAGTGGTCCCTCCAGCGTGAAATCTCTTGCAAACTGAGTTGCAGTTGTATCTCTTGGAACCGGGCTTGCTCCCCGGGCGGGTCTCCTATGATTGCTGATGGGAGGGGGGAGGGTAACCCGGCTATCATGGGAGGGGGGGAAAGGGTAGGGGATGAGTGAAATTGGGGGAAAAAAAAGAGGGGCGGGAAATC
Full Trace Sequence: GAGGGCACAAATAATTGATTTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTGTTGCACGAAGCATCGCTGCCGATCACAAAGATCTCATCCACGATGTGGCCTTTCAATTTCCAGGGCAGGAGGATGGCGACATGTTCCAGCGACCAGAGTGTGAAAGTTTGGGACAAAAGTGAAAATGGCAATTGGCATTGTACTGCGAGTTGGAAGACTCACAGTGGTTCAGTGTGGCGGGTTACATGGGCTCACCCAGAATTTGGCCAGGTATTAGCGTCTTGCTCGTTTGACAGAACTGCTGCAGTGTGGGAAGAAATAGTTGGTGAATCAAATGATAAACTACGTGGACAGAGTCATTGGGTTAAAAGAACAACACTAGTGGACAGCAGAACTTCTGTTACCGATGTAAAGTTTGCTCCAAAACACATGGGCCTGATGTTGGCGACCTGCTCTGCAGATGGAGTGGTGAGAATATATGAGGCCCCTGATGTTATGAACCTCAGCCAGTGGTCCCTCCAGCGTGAAATCTCTTGCAAACTGAGTTGCAGTTGTATCTCTTGGAACCGGGCTTGCTCCCCGGGCGGGTCTCCTATGATTGCTGATGGGAGGGGGGAGGGTAACCCGGCTATCATGGGAGGGGGGGAAAGGGTAGGGGATGAGTGAAATTGGGGGAAAAAAAAGAGGGGCGGGAAATC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTGTTGCACGAAGCATC

Sequences - 3ʹ (reverse) EST

Accession: JZ838446
dbEST ID: 79656148
Trimmed Sequence: GCTGTGCTTTCTGCCAGAAGACGGTGTTCCATTTACAGAATTCTGTAGACTCTGACCAGCTGAACCAACAGAGGATCCAAAAAAGCCTTGGTAAGAATTACCGACAGGGTTGCCATCTCCTTTGAGAACACCAATGCACTTCCAGTTGTCCATATAATTTGCCTTCCACAGTCTAACAGTGCCATCGTCACCAGATGAGGCCAAGACTGTGCCAGTTATGTTCCAACTTACTCTCCACACTTGGGAGTTGTGGTTATCAAACTGGGCTACTGTGTGGATTTCAAATTTTGTCACCCCTCCTGAAGAGCTCAATTCCTTCCTTAAAGGCTTCATGGTAAAAATTCGGACATCTTTGGTTGCCACAGCCAGTATGTGAAAAGATCTCCCCAAGTTTGGTGCAAATGCAATATCATGAACAGGGTCAGACACAGACATTAAAGTTTCTGCTTTAGCGTACTTTCTTGTGTTCTCATTATATTCATAGATCTGTACTTTTCCCATGATATTTGGGCTACGGTCATCACTGCCAACGGCAATCATAAGAGAATGGGCCCGGGAACTAGAGGGGTTCCGAGAAATAACAACTGCACCCAGTTTTCAAGAGATTTCTTGCTGGAGGGACCAATGCCTGAAGGTCA
Full Trace Sequence: CGAGCACTANGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCTGTGCTTTCTGCCAGAAGACGGTGTTCCATTTACAGAATTCTGTAGACTCTGACCAGCTGAACCAACAGAGGATCCAAAAAAGCCTTGGTAAGAATTACCGACAGGGTTGCCATCTCCTTTGAGAACACCAATGCACTTCCAGTTGTCCATATAATTTGCCTTCCACAGTCTAACAGTGCCATCGTCACCAGATGAGGCCAAGACTGTGCCAGTTATGTTCCAACTTACTCTCCACACTTGGGAGTTGTGGTTATCAAACTGGGCTACTGTGTGGATTTCAAATTTTGTCACCCCTCCTGAAGAGCTCAATTCCTTCCTTAAAGGCTTCATGGTAAAAATTCGGACATCTTTGGTTGCCACAGCCAGTATGTGAAAAGATCTCCCCAAGTTTGGTGCAAATGCAATATCATGAACAGGGTCAGACACAGACATTAAAGTTTCTGCTTTAGCGTACTTTCTTGTGTTCTCATTATATTCATAGATCTGTACTTTTCCCATGATATTTGGGCTACGGTCATCACTGCCAACGGCAATCATAAGAGAATGGGCCCGGGAACTAGAGGGGTTCCGAGAAATAACAACTGCACCCAGTTTTCAAGAGATTTCTTGCTGGAGGGACCAATGCCTGAAGGTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGTGCTTTCTGCCAGAAGAC