ORFeome > selrc1 ORF1 – XORFeome v1.0

selrc1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: selrc1
Gene ID: 6254347
Gene Page ID: 6258828
ORF Xenbase ID: 17295741

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078519
Original XGC clone length: 696

Human orthology & disease relationships

NCBI Entrez ID: 65260
Ensembl gene IDs: ENSG00000162377
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11003
Well Location: E11

Sequences - 5ʹ (forward) EST

Accession: JZ839675
dbEST ID: 79657377
Trimmed Sequence: ATGGCTGGACTAGTGGATTTTAAGAACGAGGAAGAGGTGAAAGATTACCTGGATAATCTGGGCACGGAATACTCTTACCAATGTTTTAAAGAGAAGCAGCCAGACGGCTGCAATCGGTTAGCCGAATACTTTGAAAACATCAAAAAGAACTTTGAGTCTGCAGCTGGGATATTGAAGATCAACTGTGACCAAAATGAACATAGCGAGAGTTTCTACAAACTAGGTGCTTATTATGTTACTGGGAAAGGTGGGTTACCAGTAGATCTGAAGGCCGCATACAGTTGTTTCTTGAAATCATGTAACAAAGGTGGGAAAAAATCCATCGATTCTTGCCATAATGTTGGATTATTAGCTCATGATGGACGAGTGAATGATGAGAAAGCTGATGCTGTAACAGCCAGAGATTATTATAACAAAGCCTGCGATGGCAACTTTGCAGCAAGCTGTTTTAACCTCAGTGCCACATACTTACAAGGAGCCCCTGGTATCCCCAAGGATATGAACAAGGCTTTGCATTTTTCTGAGAAAGCCTGCAGTCTGGGGCATGTATGGGGATGTGCAAATGCTAGCCGTATGTACAAACTTGGCGACGGAGTGGCAAAAAATGATGAAAAGGCAGAGTCCTTAAAGAACAGGGCCAGGGACTTACACAAGATGCAGCAGGAAAAGACACCACAAATATCATTTGGAAAATTGGCCAACTTTTCTGGACAAAGTTGGGCTTTATAAGAAAACATTGGCTTATTAATTTTTTTGCAACCAAACGGGGTTCACTATCAAGTTCAAAATAAAAATCCTTTTTTTTTTGCC
Full Trace Sequence: TCGCGGGGCCACATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTGGACTAGTGGATTTTAAGAACGAGGAAGAGGTGAAAGATTACCTGGATAATCTGGGCACGGAATACTCTTACCAATGTTTTAAAGAGAAGCAGCCAGACGGCTGCAATCGGTTAGCCGAATACTTTGAAAACATCAAAAAGAACTTTGAGTCTGCAGCTGGGATATTGAAGATCAACTGTGACCAAAATGAACATAGCGAGAGTTTCTACAAACTAGGTGCTTATTATGTTACTGGGAAAGGTGGGTTACCAGTAGATCTGAAGGCCGCATACAGTTGTTTCTTGAAATCATGTAACAAAGGTGGGAAAAAATCCATCGATTCTTGCCATAATGTTGGATTATTAGCTCATGATGGACGAGTGAATGATGAGAAAGCTGATGCTGTAACAGCCAGAGATTATTATAACAAAGCCTGCGATGGCAACTTTGCAGCAAGCTGTTTTAACCTCAGTGCCACATACTTACAAGGAGCCCCTGGTATCCCCAAGGATATGAACAAGGCTTTGCATTTTTCTGAGAAAGCCTGCAGTCTGGGGCATGTATGGGGATGTGCAAATGCTAGCCGTATGTACAAACTTGGCGACGGAGTGGCAAAAAATGATGAAAAGGCAGAGTCCTTAAAGAACAGGGCCAGGGACTTACACAAGATGCAGCAGGAAAAGACACCACAAATATCATTTGGAAAATTGGCCAACTTTTCTGGACAAAGTTGGGCTTTATAAGAAAACATTGGCTTATTAATTTTTTTGCAACCAAACGGGGTTCACTATCAAGTTCAAAATAAAAATCCTTTTTTTTTTGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGACTAGTGGATT

Sequences - 3ʹ (reverse) EST

Accession: JZ839674
dbEST ID: 79657376
Trimmed Sequence: TTCTCCAAATGATATTTGTGGTGTCCTTTCCTGCTGCATCTTGGGGTAATTCCCTGGCCCTGTTCTTTAAGGACTCTGCCTTTTCATCATTTTTTGCCACTCCGTCGCCAAGTTTGTACATACGGCTAGCATTTGCACATCCCCATACATGCCCCAGACTGCAGGCTTTCTCAGAAAAATGCAAAGCCTTGTTCATATCCTTGGGGATACCAGGGGCTCCTTGTAAGTATGTGGCACTGAGGTTAAAACAGCTTGCTGCAAAGTTGCCATCGCAGGCTTTGTTATAATAATCTCTGGCTGTTACAGCATCAGCTTTCTCATCATTCACTCGTCCATCATGAGCTAATAATCCAACATTATGGCAAGAATCGATGGATTTTTTCCCACCTTTGTTACATGATTTCAAGAAACAACTGTATGCGGCCTTCAGATCTACTGGTAACCCACCTTTCCCAGTAACATAATAAGCACCTAGTTTGTAGAAACTCTCGCTATGTTCATTTTGGTCACAGTTGATCTTCAATATCCCAGCTGCAGACTCAAAGTTCTTTTTGATGTTTTCAGAGTATTCGGCTAACCGATTGCAGCCGTCTGGCTGCTTCTCTTTAAACATTGGTAAGGAGTATTCGGTGGCCCAAATTACCCGGGTAATCCTTCCCCCTCTCCCTCTTCTTAAAATCCAAAAATCCCAGCCTAGTAGCAAACTTTTTTTGTTCAAAATTTTGGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTCCACTCA
Full Trace Sequence: GCACGGGAACANGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGNCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTCCAAATGATATTTGTGGTGTCCTTTCCTGCTGCATCTTGGGGTAATTCCCTGGCCCTGTTCTTTAAGGACTCTGCCTTTTCATCATTTTTTGCCACTCCGTCGCCAAGTTTGTACATACGGCTAGCATTTGCACATCCCCATACATGCCCCAGACTGCAGGCTTTCTCAGAAAAATGCAAAGCCTTGTTCATATCCTTGGGGATACCAGGGGCTCCTTGTAAGTATGTGGCACTGAGGTTAAAACAGCTTGCTGCAAAGTTGCCATCGCAGGCTTTGTTATAATAATCTCTGGCTGTTACAGCATCAGCTTTCTCATCATTCACTCGTCCATCATGAGCTAATAATCCAACATTATGGCAAGAATCGATGGATTTTTTCCCACCTTTGTTACATGATTTCAAGAAACAACTGTATGCGGCCTTCAGATCTACTGGTAACCCACCTTTCCCAGTAACATAATAAGCACCTAGTTTGTAGAAACTCTCGCTATGTTCATTTTGGTCACAGTTGATCTTCAATATCCCAGCTGCAGACTCAAAGTTCTTTTTGATGTTTTCAGAGTATTCGGCTAACCGATTGCAGCCGTCTGGCTGCTTCTCTTTAAACATTGGTAAGGAGTATTCGGTGGCCCAAATTACCCGGGTAATCCTTCCCCCTCTCCCTCTTCTTAAAATCCAAAAATCCCAGCCTAGTAGCAAACTTTTTTTGTTCAAAATTTTGGCTTTAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTCCACTCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTCCAAATGATATTTGTGGTGT