ORFeome > sema3f ORF1 – XORFeome v1.0

sema3f ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sema3f
Gene ID: 6252939
Gene Page ID: 940270
ORF Xenbase ID: 17295765

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124869
Original XGC clone length: 2088

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ838124
dbEST ID: 79655826
Trimmed Sequence: ATGCTGGTATCGGCATTACCTTCTCTGCTTCTGCTGCTTCTCAACTTACTCCCGTGTGTGCGAACGACGCGCCCCCCTCGAGTGTACCTTTCATACAGAGACCTCATGGAATCACGCTCTGCGCGCTCCTTTACTTTTGGGTTTAACACCAGCGACTACCGTATTCTTCTCCTGGATCAGGACCAGGACCGGATGTACGTGGGGAGTCGCGACTACGTGCTGTCTCTCGACCTCGGAAACATTAACCGGGAGCCCCTGATTATTCATTGGCCGGCTCCACTGAACCGTCACAAGGAATGTCTCATGGCAGGAAGGGGACGTGCAGACGAGTGCTACAATTACCTGCGTGTCATTCAGCCACTGAACCGCACCCATCTCTATGCGTGTGGCACGGGAGCCTACCAGCCACAATGTGCCGTTATCTACAGGGGTTGGAGATCTGAGGATTATATGTTCCGGATTGTCCCCAGCTCATTGGAGTCACGACAGGGAAGGTGTCCTTATGATCACCAACACAAAAACATGTCTACCCCTATAAACAGAATGCTGTATGCCCGCGTGCAGGTGGATTACATGAAAAACGACTCCGCTAATTTCCTGACAAATGGGAACAGAGCCTGGAAACCCCCAAACCAATTAGAAACTCCCTGGCTGAGGCACCCATTATTTTTTGGTGTCACTGGGTGGCACAGAGGACGGGCTTTCGAAAAACACCACAAACGGGAAGTCT
Full Trace Sequence: TCAGGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCTGGTATCGGCATTACCTTCTCTGCTTCTGCTGCTTCTCAACTTACTCCCGTGTGTGCGAACGACGCGCCCCCCTCGAGTGTACCTTTCATACAGAGACCTCATGGAATCACGCTCTGCGCGCTCCTTTACTTTTGGGTTTAACACCAGCGACTACCGTATTCTTCTCCTGGATCAGGACCAGGACCGGATGTACGTGGGGAGTCGCGACTACGTGCTGTCTCTCGACCTCGGAAACATTAACCGGGAGCCCCTGATTATTCATTGGCCGGCTCCACTGAACCGTCACAAGGAATGTCTCATGGCAGGAAGGGGACGTGCAGACGAGTGCTACAATTACCTGCGTGTCATTCAGCCACTGAACCGCACCCATCTCTATGCGTGTGGCACGGGAGCCTACCAGCCACAATGTGCCGTTATCTACAGGGGTTGGAGATCTGAGGATTATATGTTCCGGATTGTCCCCAGCTCATTGGAGTCACGACAGGGAAGGTGTCCTTATGATCACCAACACAAAAACATGTCTACCCCTATAAACAGAATGCTGTATGCCCGCGTGCAGGTGGATTACATGAAAAACGACTCCGCTAATTTCCTGACAAATGGGAACAGAGCCTGGAAACCCCCAAACCAATTAGAAACTCCCTGGCTGAGGCACCCATTATTTTTTGGTGTCACTGGGTGGCACAGAGGACGGGCTTTCGAAAAACACCACAAACGGGAAGTCT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTGGTATCGGCATTACCT

Sequences - 3ʹ (reverse) EST

Accession: JZ838123
dbEST ID: 79655825
Trimmed Sequence: GTTACGCTCTGTCTGAGATGCCCTTGGTCTGGGTCTCCGAGGCGGCAGGCACTGTGCTGGCATTGGAGCAAGAGTTGGTGCTGCTGTTAGTTTTTCTAGCAAGTCTCGAGGCAAAACATTCAGCCGTATTTTCCCACGTGATCGCCGGAAACCATTCTCTGTGCCTGTGCAGGTATAGACCCCTGCGTCGCTGGCTTGTACTGAGCGCAGCACTGCGCCCCCGTCAATGCCCGCCAGTCGCACCTCTCTCCGATGCTGGGAGCCCTCTCTCTGCAGCAACCAGGTAACGCTCTCGAGTGGAGAGTGAGTATCGCACTGGAGGAAAACGCTGCCGCCTTCCACACCGATCTGCAGTCGCTCTGAAATTCCTCGGTCCACTTGTGTATTGTATCCTCTGCATTGCCTTAGTGGGTCTCCATGTTTAACGTCCTGTCTCCGACTCCTCCTGCTGGGTGAAGGGGTGTAACGCACACAGCCCTTTCCATCCCAAGCACAATATGGGTCCCGGGCCAGGCAGCAGTCAGCGCAGGAATCTCCGTAACGGCTGCAGCGATGAAGAGACAGCTGGGTGACCCCAACATCTGATGAGACGTAGAGCTGGTGCCTCTTTGATGATATCCTGGAGGTTTCTAATAAGAGACGGGCACCTTGAACCCCTCCCCCCTCCCTCCAAATTGAATACTTTCTGGTTTCCTTGGGTGCCCCCGGGGGCCAGGATCATTCACTTTTCTGTAAACAATAACCCCCGGTCCTG
Full Trace Sequence: GGGGAAACTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTACGCTCTGTCTGAGATGCCCTTGGTCTGGGTCTCCGAGGCGGCAGGCACTGTGCTGGCATTGGAGCAAGAGTTGGTGCTGCTGTTAGTTTTTCTAGCAAGTCTCGAGGCAAAACATTCAGCCGTATTTTCCCACGTGATCGCCGGAAACCATTCTCTGTGCCTGTGCAGGTATAGACCCCTGCGTCGCTGGCTTGTACTGAGCGCAGCACTGCGCCCCCGTCAATGCCCGCCAGTCGCACCTCTCTCCGATGCTGGGAGCCCTCTCTCTGCAGCAACCAGGTAACGCTCTCGAGTGGAGAGTGAGTATCGCACTGGAGGAAAACGCTGCCGCCTTCCACACCGATCTGCAGTCGCTCTGAAATTCCTCGGTCCACTTGTGTATTGTATCCTCTGCATTGCCTTAGTGGGTCTCCATGTTTAACGTCCTGTCTCCGACTCCTCCTGCTGGGTGAAGGGGTGTAACGCACACAGCCCTTTCCATCCCAAGCACAATATGGGTCCCGGGCCAGGCAGCAGTCAGCGCAGGAATCTCCGTAACGGCTGCAGCGATGAAGAGACAGCTGGGTGACCCCAACATCTGATGAGACGTAGAGCTGGTGCCTCTTTGATGATATCCTGGAGGTTTCTAATAAGAGACGGGCACCTTGAACCCCTCCCCCCTCCCTCCAAATTGAATACTTTCTGGTTTCCTTGGGTGCCCCCGGGGGCCAGGATCATTCACTTTTCTGTAAACAATAACCCCCGGTCCTG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTACGCTCTGTCTGAGAT