ORFeome > sept12 ORF1 – XORFeome v1.0

sept12 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: 41153
Gene ID: 6079199
Gene Page ID: 5894592
ORF Xenbase ID: 17295819

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC057732
Original XGC clone length: 984

Human orthology & disease relationships

NCBI Entrez ID: 124404
Ensembl gene IDs: ENSG00000140623
Directly associated (OMIM) disease MIM numbers: 614822
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: F03

Sequences - 5ʹ (forward) EST

Accession: JZ824518
dbEST ID: 79642220
Trimmed Sequence: ATGGAGGAGCAGAGCCTTTCCCGGCCCGAGCTGGAGGTGGCAGAGTCCAAGAGATGCGCCGATGTCAGCCAGGAACCCATCGGATATGTGGGCATCGACACAGTGCTGGACCAGATGAGGCGCAAAGCCATGAAAAATGGCTTTGAATTCAACATTATGGTGGTGGGACAGAGCGGCTTGGGGAAATCCACCCTAGTGAACACTCTTTTCAAGTCCAAAGTGATTCGGAAATCTCCCGGCACCGCCATACCCAAAACCACGGAACTGAACTCGGTCAGTCAAGTGGTCGAGGAGAGGGGCATGGAGATGAGACTCACTGTAATCGACACACCGGGATTCGGCGACCAGATCAACAATCAGAACTGCTGGGACCCCATCATTAAGTACATACACGAGCAGTACGAGAAGTACCTGAGGGAGGAAATTCTCATCAACCGCAAGCGCCGCATCCCTGACTCCCGGATTCACAGCTGTATCTACTTCATCCCCCCCACGGGTCACTGGCTGAGACCCTTGGACTTGGAATTTATGAAGCGGTTGGGCCGGATTGTGAATGTGGTGCCGGTGATCGCTAAAGCAGATACTCTCACCTTGGAAGAGAGGGAGGATTCAAACAGAGGATACGAAAGGACCTACAGACTAACGGGNATCAGTGTGTACCCACAGCCAGAGCTGGATGAAGATCNNGGTTTGAGCGTTACTGAAATGACAAATCCCGGGAGAAGATTCATTTCTCCCTGGGTGGGAACACGATAAAGAAGAATCAGGTGAACGGGGCGGGAAAATCCTGGGGCCCCAAAAACCAATGGGTGGGGAAACAAAATAAAATTGTAAAAACCCAGGCCCCACGGG
Full Trace Sequence: TAATGAATTTTATTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGCAGAGCCTTTCCCGGCCCGAGCTGGAGGTGGCAGAGTCCAAGAGATGCGCCGATGTCAGCCAGGAACCCATCGGATATGTGGGCATCGACACAGTGCTGGACCAGATGAGGCGCAAAGCCATGAAAAATGGCTTTGAATTCAACATTATGGTGGTGGGACAGAGCGGCTTGGGGAAATCCACCCTAGTGAACACTCTTTTCAAGTCCAAAGTGATTCGGAAATCTCCCGGCACCGCCATACCCAAAACCACGGAACTGAACTCGGTCAGTCAAGTGGTCGAGGAGAGGGGCATGGAGATGAGACTCACTGTAATCGACACACCGGGATTCGGCGACCAGATCAACAATCAGAACTGCTGGGACCCCATCATTAAGTACATACACGAGCAGTACGAGAAGTACCTGAGGGAGGAAATTCTCATCAACCGCAAGCGCCGCATCCCTGACTCCCGGATTCACAGCTGTATCTACTTCATCCCCCCCACGGGTCACTGGCTGAGACCCTTGGACTTGGAATTTATGAAGCGGTTGGGCCGGATTGTGAATGTGGTGCCGGTGATCGCTAAAGCAGATACTCTCACCTTGGAAGAGAGGGAGGATTCAAACAGAGGATACGAAAGGACCTACAGACTAACGGGNATCAGTGTGTACCCACAGCCAGAGCTGGATGAAGATCNNGGTTTGAGCGTTACTGAAATGACAAATCCCGGGAGAAGATTCATTTCTCCCTGGGTGGGAACACGATAAAGAAGAATCAGGTGAACGGGGCGGGAAAATCCTGGGGCCCCAAAAACCAATGGGTGGGGAAACAAAATAAAATTGTAAAAACCCAGGCCCCACGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGAGCAGAGCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829870
dbEST ID: 79647572
Trimmed Sequence: CAAAACCCCCAGCTCTTTTGTCTGTGATGACTGGAATTTCTCGTTCAGCCTGCTGACCCTGTAGGTCTCATAATGGATGTTGTGGGTTATGTCTTTAAGGTCCTGCAGGTTGGATCGGATGAGCAGATCCCGGAGGTTGGCAAATTCACAGTGCGCCGTGTTCTCAACTTCTATGATTCCCCACTTGGTCTTTCGGCCCAAGACTTTCCTGCCGTTCACCTGATGCTCCTCATCTGTTCCCACCACGGCGAATGGAATCTTCTCCCGGATTTTGTCATTCAGTAACGCCTCAACCGGATCTTCATCCAGCTCTGGCTGTGGGTACACACTGATCCCGTTAGTCTGTAGGTCCTTTCGTATCCTCTGTTTGAATTCCTCCCTCTCTTCCAAGGTGAGAGTATCTGCTTTAGCGATCACCGGCACCACATTCACAATCCGGCCCAACCGCTTCATAAATTCCAAGTCCAAGGGTCTCAGCCAGTGACCCGTGCGGGGGATGAAGTAGATACAGCTGTGAATCCGGGAGTCAGGGATGCGGCGCTTGCGGTTGATGAGAATTTCCTCCCTCANGTACTTCTCGTACTGCTCGTGTATGTACTTAATGATGGGGTCCCAGCAGTTCTGATTGTTGATCTGGTCGCCGAAATCCCGGTGTGTCGATTACAGTGAGTCTCATCTCCATGCCCCCCTCTCTCGACCACTTGGACTGAACCAAGTTTCAGTTCCCG
Full Trace Sequence: CGGGGCATCAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAAAACCCCCAGCTCTTTTGTCTGTGATGACTGGAATTTCTCGTTCAGCCTGCTGACCCTGTAGGTCTCATAATGGATGTTGTGGGTTATGTCTTTAAGGTCCTGCAGGTTGGATCGGATGAGCAGATCCCGGAGGTTGGCAAATTCACAGTGCGCCGTGTTCTCAACTTCTATGATTCCCCACTTGGTCTTTCGGCCCAAGACTTTCCTGCCGTTCACCTGATGCTCCTCATCTGTTCCCACCACGGCGAATGGAATCTTCTCCCGGATTTTGTCATTCAGTAACGCCTCAACCGGATCTTCATCCAGCTCTGGCTGTGGGTACACACTGATCCCGTTAGTCTGTAGGTCCTTTCGTATCCTCTGTTTGAATTCCTCCCTCTCTTCCAAGGTGAGAGTATCTGCTTTAGCGATCACCGGCACCACATTCACAATCCGGCCCAACCGCTTCATAAATTCCAAGTCCAAGGGTCTCAGCCAGTGACCCGTGCGGGGGATGAAGTAGATACAGCTGTGAATCCGGGAGTCAGGGATGCGGCGCTTGCGGTTGATGAGAATTTCCTCCCTCANGTACTTCTCGTACTGCTCGTGTATGTACTTAATGATGGGGTCCCAGCAGTTCTGATTGTTGATCTGGTCGCCGAAATCCCGGTGTGTCGATTACAGTGAGTCTCATCTCCATGCCCCCCTCTCTCGACCACTTGGACTGAACCAAGTTTCAGTTCCCG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAAAACCCCCAGCTCTTTTGTC