ORFeome > serhl2 ORF1 – XORFeome v1.0

serhl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: serhl2
Gene ID: 6256337
Gene Page ID: 943364
ORF Xenbase ID: 17295873

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045088
Original XGC clone length: 915

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: G07

Sequences - 5ʹ (forward) EST

Accession: JZ824060
dbEST ID: 79641762
Trimmed Sequence: ATGTCTGCACTTCTGAAAGAATTGAGGTTTTCTGTCCCCTGGGGACAATTAGCAGCTAAAGCCTGGGGTCCTAGTGAAGGCCGTCCTGTGCTTTGCCTGCATGGCTGGTTGGATAATGCGAACACATTTGACAGACTGATTCCATTACTTCCAAATGATCATCATTTTGTGGCTTTAGATTTCTCGGGACATGGGCTGTCATCCCATTTGCCTGAAGGCGTGAGATACCAACACATTGACTATGTGACGGACATACACAGAGTGGTAACACAATTGGGTTGGCGACAATTCTCAATAATGGGACACAGTATGGGCGGAGTTGTCGGTGGATTATTTGCTTCTGTTTTTCCTGAGTTGGTCAAGAAACTCATATTGCTGGATTCTTATGGATTCTTCCCAGTTAATGCGGACATGATCCAGACTCACCTGAAAAAGACAATAAACTATTATTCTCGCTTGGAGGGTGTGAGTGCTGGAAAATTATACTCGCCAGAAGGTGCTCTGCAGAGGCTGTTGGAAGCAAATGCCAGTCTAACATTGGAATCTGGAAAGTTGCTGCTGCAACGTGGTACTAAGCCTGTGGAAGGGGGGTGTGGTCTTCAGCCGCGACATCAGGGTAACTGTGAACAATTCATTACCTCTCTCCACAGAGCAGTGCCTTTTGATGCTGAGCAAAACTCAGGCGGAAGTAACATTATCATGGCTAACGAGGGGCTCACAGCTGACATGATGCGAGGGGTTTATACGGATGTGGGAACAGCCTTTATTGAAAGATTTCAAGAAAAGTCTAAAGGAACCGTTGCCCGGGTTACAGTTTGTGTGAAGGGGAACCCACTTTTGGTT
Full Trace Sequence: TAATGAATTTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTGCACTTCTGAAAGAATTGAGGTTTTCTGTCCCCTGGGGACAATTAGCAGCTAAAGCCTGGGGTCCTAGTGAAGGCCGTCCTGTGCTTTGCCTGCATGGCTGGTTGGATAATGCGAACACATTTGACAGACTGATTCCATTACTTCCAAATGATCATCATTTTGTGGCTTTAGATTTCTCGGGACATGGGCTGTCATCCCATTTGCCTGAAGGCGTGAGATACCAACACATTGACTATGTGACGGACATACACAGAGTGGTAACACAATTGGGTTGGCGACAATTCTCAATAATGGGACACAGTATGGGCGGAGTTGTCGGTGGATTATTTGCTTCTGTTTTTCCTGAGTTGGTCAAGAAACTCATATTGCTGGATTCTTATGGATTCTTCCCAGTTAATGCGGACATGATCCAGACTCACCTGAAAAAGACAATAAACTATTATTCTCGCTTGGAGGGTGTGAGTGCTGGAAAATTATACTCGCCAGAAGGTGCTCTGCAGAGGCTGTTGGAAGCAAATGCCAGTCTAACATTGGAATCTGGAAAGTTGCTGCTGCAACGTGGTACTAAGCCTGTGGAAGGGGGGTGTGGTCTTCAGCCGCGACATCAGGGTAACTGTGAACAATTCATTACCTCTCTCCACAGAGCAGTGCCTTTTGATGCTGAGCAAAACTCAGGCGGAAGTAACATTATCATGGCTAACGAGGGGCTCACAGCTGACATGATGCGAGGGGTTTATACGGATGTGGGAACAGCCTTTATTGAAAGATTTCAAGAAAAGTCTAAAGGAACCGTTGCCCGGGTTACAGTTTGTGTGAAGGGGAACCCACTTTTGGTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTGCACTTCTGAAAGAATTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829370
dbEST ID: 79647072
Trimmed Sequence: GAGATTGCATTGGAGATATGACCTTGCATGTAGAAAATCAAAGATGATATTAGCCACCTTTTCTGGCTCATTCAGATGAACAAAGTGGTTCCCATCCACAACTGTAACCTGGCAACGCTCCTTTAGACTTTCTTTGAATCCTTTCAATAAGGCTTGTCCCACATCCGTATAAACCCCTCGCATCATGTCAGCTGTGAGCCCCTCGTTAGCCATGATAATGTTTACTTCCGCCTGAGTTTTGCTCAGCATCAAAAGGCACTGCTCTGTGGAGAGAGGTAATGAATTGTTCACAGTTACCCTGATGTCGCGGCTGAAGACCACACCCCCTTCCACAGGCTTAGTACCACGTTGCAGCAGCAACTTTCCAGATTCCAATGTTAGACTGGCATTTGCTTCCAACAGCCTCTGCAGAGCACCTTCTGGCGAGTATAATTTTCCAGCACTCACACCCTCCAAGCGAGAATAATAGTTTATTGTCTTTTTCAGGTGAGTCTGGATCATGTCCGCATTAACTGGGAAGAATCCATAAGAATCCAGCAATATGAGTTTCTTGACCAACTCCNGAAAAACAGAAGCAAATAATCCACCGACAACTCCCCCCATACTGTGTCCCATTTATTGAGAATTGTCGCCCAACCCAATTGTGTTACCCACTCTGGTGTATGTCCCTTCACCATATTCAATGGTGTTTGGTATCTCCACGCCTTCCAGGGCAAAGGGGGAAGAACAGCCCATTGGTCCCCGAGGAAAATCCAAAAGCCCCAAAAAAAATGGAT
Full Trace Sequence: CCGGGAATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGATTGCATTGGAGATATGACCTTGCATGTAGAAAATCAAAGATGATATTAGCCACCTTTTCTGGCTCATTCAGATGAACAAAGTGGTTCCCATCCACAACTGTAACCTGGCAACGCTCCTTTAGACTTTCTTTGAATCCTTTCAATAAGGCTTGTCCCACATCCGTATAAACCCCTCGCATCATGTCAGCTGTGAGCCCCTCGTTAGCCATGATAATGTTTACTTCCGCCTGAGTTTTGCTCAGCATCAAAAGGCACTGCTCTGTGGAGAGAGGTAATGAATTGTTCACAGTTACCCTGATGTCGCGGCTGAAGACCACACCCCCTTCCACAGGCTTAGTACCACGTTGCAGCAGCAACTTTCCAGATTCCAATGTTAGACTGGCATTTGCTTCCAACAGCCTCTGCAGAGCACCTTCTGGCGAGTATAATTTTCCAGCACTCACACCCTCCAAGCGAGAATAATAGTTTATTGTCTTTTTCAGGTGAGTCTGGATCATGTCCGCATTAACTGGGAAGAATCCATAAGAATCCAGCAATATGAGTTTCTTGACCAACTCCNGAAAAACAGAAGCAAATAATCCACCGACAACTCCCCCCATACTGTGTCCCATTTATTGAGAATTGTCGCCCAACCCAATTGTGTTACCCACTCTGGTGTATGTCCCTTCACCATATTCAATGGTGTTTGGTATCTCCACGCCTTCCAGGGCAAAGGGGGAAGAACAGCCCATTGGTCCCCGAGGAAAATCCAAAAGCCCCAAAAAAAATGGAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGATTGCATTGGAGATATGAC