ORFeome > serp1 ORF1 – XORFeome v1.0

serp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: serp1
Gene ID: 1004965
Gene Page ID: 1004957
ORF Xenbase ID: 17295891

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078563
Original XGC clone length: 201

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11005
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ839886
dbEST ID: 79657588
Trimmed Sequence: ATGGTAGCCAAGCAGAGAATCCGCATGGCCAACGAGAAGCACAGCAAGAATATCACACAGAGAGGCAACGTGGCCAAGTCAACGAGAAATGTGACGGAGGAGAAATCTGCAGTGGGACCCTGGTTACTGGCGCTCTTTATATTCGTGGTCTGTGGATCCGCTATTTTCCAGATTATTCAGAGCATCAGGATGGGCATGTT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTAGCCAAGCAGAGAATCCGCATGGCCAACGAGAAGCACAGCAAGAATATCACACAGAGAGGCAACGTGGCCAAGTCAACGAGAAATGTGACGGAGGAGAAATCTGCAGTGGGACCCTGGTTACTGGCGCTCTTTATATTCGTGGTCTGTGGATCCGCTATTTTCCAGATTATTCAGAGCATCAGGATGGGCATGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGTCTCAAAAGAAAACAAGAAACAAAAAATTCTAAGATACGGCAATGCAGGGGGGGGACAAAGGCCAAGGTTCCCCGCCACACAGGGCGCGGGGGTTGTCTTCTCTGTTTTGGGGGGAAGGCGCCAAACCCGAACACTAGAAAGGGGGGGTTGGAAGGGTATATAAAAAAGCCAAGGGGGCCCGCCCCCCGGGCCCAAAACGTAAAAAACCAAGGGGGGGAGGGGGGGGGGGGGGTGATCTTGTTTTTGATATGGTTTTTTTGTTTTTTTCTTGGCCTCGTCCCCACCACACCAAACCTCCACCCTTTGGCGGGTGTGGTTATTGAGCACAAAAAAAAAAACAAACAAGCCGCGCTCCCCCCGAAGAAGAAAAATATATAAGGGGGAGGGGGGGGGAGAAACGAATTTCCTACCCAAAAAAAAAAAAGTGTTTGGGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAGCCAAGCAGAGA

Sequences - 3ʹ (reverse) EST

Accession: JZ839885
dbEST ID: 79657587
Trimmed Sequence: CATGCCCATCCTGATGCTCTGAATAATCTGGAAAATAGCGGATCCACAGACCACGAATATAAAGAGCGCCAGTAACCAGGGTCCCACTGCAGATTTCTCCTCCGTCACATTTCTCGTTGACTTGGCCACGTTGCCTCTCTGTGTGATATTCTTGCTGTGCTTCTCGTTGGCCATGCGGATTCTCTGCTTGGCTACCATGG
Full Trace Sequence: GAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGGATGGAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACATGCCCATCCTGATGCTCTGAATAATCTGGAAAATAGCGGATCCACAGACCACGAATATAAAGAGCGCCAGTAACCAGGGTCCCACTGCAGATTTCTCCTCCGTCACATTTCTCGTTGACTTGGCCACGTTGCCTCTCTGTGTGATATTCTTGCTGTGCTTCTCGTTGGCCATGCGGATTCTCTGCTTGGCTACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCAACCTTAATACTGGCCGTCGTTAAAAAAAAAAAAGAAAGAAAATAATCAAAACCCCCCAAACCAGGGCGGGAAAAAAAACAACAGAACCCCCCCCACAAGGGGCTGGGTGGGTGGTCTTTGGTAAAAGGAAGGCCGAAAAACCACGAAAAAGAAAGCGGGGGGTGGTTGAATTTTTAAGAAAAAAACCGGGCGCGCCCCCCATGGGCCCAAAAAAAAAAAAAAAACGGGGGGGGGGGGGGGGGGGGGGGGTTTTTTCGTTGTTGTTATTTTTTTTTTTGTTTTTTGTCTCTCTTCCCCCCCGGCCCCAACCCCGCGCCCTTCTCCCCGTCGGAGTGGTGTATGAAGTGGAGGGAAAAAAAAAACAAGACACCGACCCGCCCCGCGAGGGGAAAAAGAAAGATAGTGAATGGGGGAAGGAAGGAGGGAGAGTAGGCACACAAATACCAAAAACAACGAAGGAGAGGGGGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACATGCCCATCCTGATGCT