ORFeome > serpina1 ORF1 – XORFeome v1.0

serpina1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: serpina1
Gene ID: 5804592
Gene Page ID: 5804365
ORF Xenbase ID: 17295897

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054235
Original XGC clone length: 1299

Human orthology & disease relationships

NCBI Entrez ID: 5265
Ensembl gene IDs: ENSG00000197249
Directly associated (OMIM) disease MIM numbers: 606963,613490
Indirectly associated (Lage, et al.) disease MIM numbers: 162800,188050,217090,231200,238600,603813

Library Location

Plate ID: GDExl11003
Well Location: D09

Sequences - 5ʹ (forward) EST

Accession: JZ839588
dbEST ID: 79657290
Trimmed Sequence: ATGAAGGTCTTATTGGTTGTTAGCCTAGCCCTGCCTTGTGCAGGGGTCTTGGCTGACCATCATAAACATGGTAAAGACAATGCCCACAATGGCCATGACCACGGAGATCATGACCACGACCATCACCATGGTAAAGGAAAAGATCATGATCACAAGCACCATCGCCATTCTGGAGAAACCATGTCTTGCCACAAAATAGCACCATTCAATGCCCAATTTGCTTTCGAATTCTACAGGCAAGTAGCTGCAGACCATCCATCAGAAAACATTTTCTTTTCTCCAGTGAGTATTTCCACTGCATTTTCTATGCTCTCATTAGGTGCCAAAGGACAAACTTTAAACCAGATCATAGAAGGACTGGGCTTTAACACAACTGAAATATCAGAGGAGGAGATTCATAACGGCTTCCAGCATCTCCTTCACATGCTGAATGACCCAGACAGTGAATTGCAGCTGAACAGTGGAAACGCCCTCTTCATAGACAATAACATGAAGCTAATTCAGAAATTCTTAGAAGATGTAAAAGAATTCTATGAATCAGAAGCTTTTTCTACTGACTTCCATAATACAAAGGAAGCAACAAAACAGATTAACAGTTATGTAGAGAAGAGNACTCATGGCAAAATCACTGACTTGCTTAAAGATGTTGACGAGAGAACTCTTTTAATCCTTATANCTACATTTACTTCAGAGGAAAGTGGGAGAAGCCATTTTGAGAGAATTTTACACAGATGGATCCNTCCATGTGGATTAAAAACACAAATGGGAACCGTCCACATAATCCCCCAAAATTGGGCATGAAAAAAAG
Full Trace Sequence: TCGCGGGCCATATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGTCTTATTGGTTGTTAGCCTAGCCCTGCCTTGTGCAGGGGTCTTGGCTGACCATCATAAACATGGTAAAGACAATGCCCACAATGGCCATGACCACGGAGATCATGACCACGACCATCACCATGGTAAAGGAAAAGATCATGATCACAAGCACCATCGCCATTCTGGAGAAACCATGTCTTGCCACAAAATAGCACCATTCAATGCCCAATTTGCTTTCGAATTCTACAGGCAAGTAGCTGCAGACCATCCATCAGAAAACATTTTCTTTTCTCCAGTGAGTATTTCCACTGCATTTTCTATGCTCTCATTAGGTGCCAAAGGACAAACTTTAAACCAGATCATAGAAGGACTGGGCTTTAACACAACTGAAATATCAGAGGAGGAGATTCATAACGGCTTCCAGCATCTCCTTCACATGCTGAATGACCCAGACAGTGAATTGCAGCTGAACAGTGGAAACGCCCTCTTCATAGACAATAACATGAAGCTAATTCAGAAATTCTTAGAAGATGTAAAAGAATTCTATGAATCAGAAGCTTTTTCTACTGACTTCCATAATACAAAGGAAGCAACAAAACAGATTAACAGTTATGTAGAGAAGAGNACTCATGGCAAAATCACTGACTTGCTTAAAGATGTTGACGAGAGAACTCTTTTAATCCTTATANCTACATTTACTTCAGAGGAAAGTGGGAGAAGCCATTTTGAGAGAATTTTACACAGATGGATCCNTCCATGTGGATTAAAAACACAAATGGGAACCGTCCACATAATCCCCCAAAATTGGGCATGAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGTCTTATTGGTTGTTAGC

Sequences - 3ʹ (reverse) EST

Accession: JZ839587
dbEST ID: 79657289
Trimmed Sequence: ATTCTTAGGGTTTGTAATTCTTCCAAGAAATAGGGTGCTCCTTGTTTCCTGATCGTAAATAGTAATCAGGAAAGGCTGATTAAATTTGATGTTTGGTGGGATCATCATGGGCATAATCTCAAAAGCAGTAGCTGCAGCAGCTTCTGTTCCTTTCTCATCAATGCTCAAAACAGCCTTATGAAGTGCCTTAGACACCTTGAGTCTGGATGCCGCAATCCCAGTAAGATCAGCTAGATCTGAAAAAACATCCTTCACTCCAAATTTCTTAAACACCTCTACAAGATCAAGTTCTGCCGAGACTGAGAATTTGGGAATAGTTAAATCTACAGATCGATATCCAAATAGCTTTTTCCAGGACATTATTGTTGACTTTTCTAGAGCTTCTTCCACTTGTTTGAGCTTGCCTTCATCCGGCAAAATAAATAGTGATGTTGCATTCCCTTTGTATGGGATCTGTACCACCGTGCAGCCGAGCTTATCATCGAATGCCACATTGTACATGCCATTTCTGCGCATCATTGGAACGGTCACATTTGTGTTCTCATCCACATGGAAGATTCCATCCTGTGGTAACTCTTCTTCAAATGGCTTCCTCCAATTTTCCTCTGAAGTAAAATGGAGTTAATAAGGAATTAAAAAAGATTTTTCTCGTTCAACATCCTTTAACAAAATTCAATGAAAATTTTGCCCATGGAATTTTTTTCTTCCTCAACATTAACTTGGTTAAAACCCTGTTTTTTGGTTTTCCTTTTCCTTTTTTTT
Full Trace Sequence: CGGGCAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCGTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTTAGGGTTTGTAATTCTTCCAAGAAATAGGGTGCTCCTTGTTTCCTGATCGTAAATAGTAATCAGGAAAGGCTGATTAAATTTGATGTTTGGTGGGATCATCATGGGCATAATCTCAAAAGCAGTAGCTGCAGCAGCTTCTGTTCCTTTCTCATCAATGCTCAAAACAGCCTTATGAAGTGCCTTAGACACCTTGAGTCTGGATGCCGCAATCCCAGTAAGATCAGCTAGATCTGAAAAAACATCCTTCACTCCAAATTTCTTAAACACCTCTACAAGATCAAGTTCTGCCGAGACTGAGAATTTGGGAATAGTTAAATCTACAGATCGATATCCAAATAGCTTTTTCCAGGACATTATTGTTGACTTTTCTAGAGCTTCTTCCACTTGTTTGAGCTTGCCTTCATCCGGCAAAATAAATAGTGATGTTGCATTCCCTTTGTATGGGATCTGTACCACCGTGCAGCCGAGCTTATCATCGAATGCCACATTGTACATGCCATTTCTGCGCATCATTGGAACGGTCACATTTGTGTTCTCATCCACATGGAAGATTCCATCCTGTGGTAACTCTTCTTCAAATGGCTTCCTCCAATTTTCCTCTGAAGTAAAATGGAGTTAATAAGGAATTAAAAAAGATTTTTCTCGTTCAACATCCTTTAACAAAATTCAATGAAAATTTTGCCCATGGAATTTTTTTCTTCCTCAACATTAACTTGGTTAAAACCCTGTTTTTTGGTTTTCCTTTTCCTTTTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTTAGGGTTTGTAATTCTTCC