ORFeome > serpinc1 ORF1 – XORFeome v1.0

serpinc1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: serpinc1
Gene ID: 975787
Gene Page ID: 975781
ORF Xenbase ID: 17295933

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC041211
Original XGC clone length: 1371

Human orthology & disease relationships

NCBI Entrez ID: 462
Ensembl gene IDs: ENSG00000117601
Directly associated (OMIM) disease MIM numbers: 613118
Indirectly associated (Lage, et al.) disease MIM numbers: 166220,188050,188055,202400,231200,277450

Library Location

Plate ID: GDExl11008
Well Location: H02

Sequences - 5ʹ (forward) EST

Accession: JZ823600
dbEST ID: 79641302
Trimmed Sequence: ATGTATCTGCTTTCATTGTTGCTTCTCAGCCTCTTGGGCTCAGCATACCTCCAGCCACAGCATGCTGACATATGCCTGGCAAAACCTAAAGATATACCTCTGACTCCCATGTGTGTCTACCGGAAACCTCTGGAGGTGGTTGAAACCGAGGAAAAGGAGAAAGAACCTACAACGCAAGAACAGAAGGTTCCTGAGTCCACTAACCCTCGTGTATATGAGCTCTCCCAGGCCAATGCTAAATTTGCAATTGCTTTCTATAAAAATCTCGCTGACTCCAAGCGTGACAAAGAAAATATCTTTATGTCACCCCTGAGCATCTCTCAAGCCTTTACAATGGCAAAACTGGGTGCCTGCAATAACACACTGAAGCAACTTATGGAGGTATTCCACTTTGACACAGTTTCAGAGCGGGCTTCTGATCAAATACACTACTTCTTTGCAAAGCTCAACTGCCGCCTGTTCAGAAAAGCAAACAAGTCATCCGAACTGGTATCTGTCAATCGCCTTTTTGGTGAGAAGTCTCTGACCTTTAATGAAACCTATCAAGATATCAGTGAGATAGTGTATGGGGCTAAATTGTGGCCCTTAAACTTTAGGGATAAGCCTGAACTATCCCGTGAAATAATTAATAATTGGGTATCCAATAAAACAGAGAAGCGAATAACTGATGTGATCCCTAANGACGCCATCACTCCTGACACAGTATTGGTGCTGAATAATGCCATCTACTTTCAGGGACTTTGGAAATCCCAAGTTAATTCAGAAAATAC
Full Trace Sequence: TAATGAATTTTATTTATGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTATCTGCTTTCATTGTTGCTTCTCAGCCTCTTGGGCTCAGCATACCTCCAGCCACAGCATGCTGACATATGCCTGGCAAAACCTAAAGATATACCTCTGACTCCCATGTGTGTCTACCGGAAACCTCTGGAGGTGGTTGAAACCGAGGAAAAGGAGAAAGAACCTACAACGCAAGAACAGAAGGTTCCTGAGTCCACTAACCCTCGTGTATATGAGCTCTCCCAGGCCAATGCTAAATTTGCAATTGCTTTCTATAAAAATCTCGCTGACTCCAAGCGTGACAAAGAAAATATCTTTATGTCACCCCTGAGCATCTCTCAAGCCTTTACAATGGCAAAACTGGGTGCCTGCAATAACACACTGAAGCAACTTATGGAGGTATTCCACTTTGACACAGTTTCAGAGCGGGCTTCTGATCAAATACACTACTTCTTTGCAAAGCTCAACTGCCGCCTGTTCAGAAAAGCAAACAAGTCATCCGAACTGGTATCTGTCAATCGCCTTTTTGGTGAGAAGTCTCTGACCTTTAATGAAACCTATCAAGATATCAGTGAGATAGTGTATGGGGCTAAATTGTGGCCCTTAAACTTTAGGGATAAGCCTGAACTATCCCGTGAAATAATTAATAATTGGGTATCCAATAAAACAGAGAAGCGAATAACTGATGTGATCCCTAANGACGCCATCACTCCTGACACAGTATTGGTGCTGAATAATGCCATCTACTTTCAGGGACTTTGGAAATCCCAAGTTAATTCAGAAAATAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTATCTGCTTTCATTGTTGCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ828899
dbEST ID: 79646601
Trimmed Sequence: TTCAGTGCAGGGGTTAGCTACTCTCCCCATGAACAAAATAGCATTTATAGCAACTTCTCGGATAAAGACCAGGAAGGGCCTATTGGCTCTGAATATGATCCGGTTCAGGTTCAAAGAACGTCCTGTCAAAATCACGGCAGTGGATGCGGCTGCCTCACTACCCTCCTCGTTGACCTCTAAAAATGCCTTATGGAAAGCATCGGACACATACAAGTCTGTCCTTCCTCCTGCAATGATTCCTGGAAGCTTTGCTGAGTTTGGATCAAACAGGTCTACCAATCCCATTTCCTGTAATTTCTCCTTAACACTGAAGGAATCTTCCACCCGGAATCGAGGGAGATAAACAGATAACTGTAATTCTCGAGACTTCTGGAGCCAATTCCCAAGCTTTTCCAGTGTCAGGTTCTGCTCCACTGTTGTTAGCGGAGTCTCTTGCGAAGGTAGCACCAGCACCATTGTAATGTCATCACCTTTATAAGGCAGCTCAAGGACCTGAACTCCATCATCTTTAAAGGAACCATAACGGAATGTACCCTCTTGATACATGGTTGCAGTCAAGCAGTTGGAATTTTTAGCTGGGTGGAAATGGTCCATTTTCGTATTTTCCGAATAAAACTTGGATTTCCAAAGTCCCTTGGAAGTAAATGGCATTTATCAGCACCCAATACTGGTGTCAGGGAGTGATTGGCGT
Full Trace Sequence: GCTGACGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCAGTGCAGGGGTTAGCTACTCTCCCCATGAACAAAATAGCATTTATAGCAACTTCTCGGATAAAGACCAGGAAGGGCCTATTGGCTCTGAATATGATCCGGTTCAGGTTCAAAGAACGTCCTGTCAAAATCACGGCAGTGGATGCGGCTGCCTCACTACCCTCCTCGTTGACCTCTAAAAATGCCTTATGGAAAGCATCGGACACATACAAGTCTGTCCTTCCTCCTGCAATGATTCCTGGAAGCTTTGCTGAGTTTGGATCAAACAGGTCTACCAATCCCATTTCCTGTAATTTCTCCTTAACACTGAAGGAATCTTCCACCCGGAATCGAGGGAGATAAACAGATAACTGTAATTCTCGAGACTTCTGGAGCCAATTCCCAAGCTTTTCCAGTGTCAGGTTCTGCTCCACTGTTGTTAGCGGAGTCTCTTGCGAAGGTAGCACCAGCACCATTGTAATGTCATCACCTTTATAAGGCAGCTCAAGGACCTGAACTCCATCATCTTTAAAGGAACCATAACGGAATGTACCCTCTTGATACATGGTTGCAGTCAAGCAGTTGGAATTTTTAGCTGGGTGGAAATGGTCCATTTTCGTATTTTCCGAATAAAACTTGGATTTCCAAAGTCCCTTGGAAGTAAATGGCATTTATCAGCACCCAATACTGGTGTCAGGGAGTGATTGGCGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCAGTGCAGGGGTTAGCTACTC