ORFeome > serpine1 ORF1 – XORFeome v1.0

serpine1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: serpine1
Gene ID: 969642
Gene Page ID: 969638
ORF Xenbase ID: 17295945

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123188
Original XGC clone length: 1212

Human orthology & disease relationships

NCBI Entrez ID: 5054
Ensembl gene IDs: ENSG00000106366
Directly associated (OMIM) disease MIM numbers: 613329
Indirectly associated (Lage, et al.) disease MIM numbers: 122700,188050,202400,217090,231200,277450,606764,606843

Library Location

Plate ID: GDExl11088
Well Location: B09

Sequences - 5ʹ (forward) EST

Accession: JZ838335
dbEST ID: 79656037
Trimmed Sequence: ATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCTTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAAATTTCAAGCAACTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAATGGCAAATGGACTGTCCCATTCCCGGACAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTTATTGTGCAAATGATGGCCAACACTGGGGAAATACAACTAACGGTGAATTTACAACCCCCAAAATGGGATTTTTTATAAATTTTATAAAACTTTCCCAATTTAAAAGGAAAAAAAACCTCCAACAATGATTAATTTGCCTGCCTCCCCTTAA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCATACAACATAAGGTGCATGCTGGTCTTCTTACTTTCCTTGACACTGGTAACTTCTGCCCAAAATAGAATATCTCGCGTGGCTCAGAAAGGCACACGTTTTGGGTTACGTTTGTTTCAAGAGGTTCTTGTAGACCAACGGGGGAAGAACCTGGGCTTCTCGCCTTATGGGGTAATGTCCGCCTTGACCGTCCTTCAGTCAGGAGCAGCTGGGAAAACATTGGATCAGATCCGCAAAGCTTTAAATTTTGGACAGAAAGAATGGGCGGTGGCCTTGTCACTTCATAAGCTGAGGGTACAGATCTCCAGACAACAAAAATCTACTGAAGACCCCAAGCCAGTACACGTTGCAGATGGTCTCTTTGTACAGCGGGACCTGTCACTGACCCCAGGGTTCCTTCAAAAATTTCAAGCAACTTTCCACCGACATGTTAGCCAAATCAATTTTACTGATGCAGCCCAAGCCAAGGACATCATTAATCAATGGGTAGAGAAAAAAACAGATGGTATGATCAAAGATTTAGTGGGGAGCAACAACATACCTCCACTGACCCGTCTTGTGCTATTAAGTGCTATACACTTCAATGGCAAATGGACTGTCCCATTCCCGGACAAGGCAACACACCAGCGCCCATTCTACAGATCTGATGGGTCTCACGTTATTGTGCAAATGATGGCCAACACTGGGGAAATACAACTAACGGTGAATTTACAACCCCCAAAATGGGATTTTTTATAAATTTTATAAAACTTTCCCAATTTAAAAGGAAAAAAAACCTCCAACAATGATTAATTTGCCTGCCTCCCCTTAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCATACAACATAAGGTGCATG

Sequences - 3ʹ (reverse) EST

Accession: JZ838334
dbEST ID: 79656036
Trimmed Sequence: GGGCTCCATGACTTGTCCCACGAATAGCAGTGTACCTGTTGGGTTGTGTCTGACCATGAACAAGAAAGGATGGTCCATGATAACCTCCAGAGGAGCCATTCGAGCTAGCAGGATAGCAGCTGTTGCTGCAGATGCTCTCGTACCCCTTTCTGTCACTTCCACCTTGATTTTTTGAAAAGCTTCAGAAACATATAGTGGTTTTTCAGAGGACAAGCGGCTGAAGTCTGCCATCTCTTCAGTGAACATGTTAGTAATTCCCAGACGTTCTAGAGGCTTCTTCAGATCTACTTCACTAAGCAGAGAGAACTTGGGTAGGACTAGAAGTCGTGCTACTTTCTTCATTTGGGCTTTCCACTGGACAATGAGCTCAGATGTCAGGATGTTGGTGATGGTGGATAAGGGAACACCTTTTTCATAAGGAGCAGCAATAATCATGCTGAGCTCCTCTCCTTCATATGGCAGCTCTATCACATCATAAAAATCCCCATCTGGGGTTGTGAACTCACCGTAGTTGTATTTCCCAGTGTTGGCCATCATTTGGCACAATCCGTGAGACCCATCAAATCTGTAAAAATGGGCGCTGGTGTGTTGCCTTTCTCCGAAATGGGACAGTCCATATTGCCAGTGAAATGTATAACAACTTAATAATCAAAAAAAGGGTACAGTGAAAGGAATGTTTGTTGGTCCCCCCCAAAATCTTTAAAACATAAAAACCCGTTTTTTTTTTTTCCTAACCCATATGAATAAAAGAATTGTCCCTTTGTGCTTTTGGGGCGG
Full Trace Sequence: GGGAATCTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCACGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGGCTCCATGACTTGTCCCACGAATAGCAGTGTACCTGTTGGGTTGTGTCTGACCATGAACAAGAAAGGATGGTCCATGATAACCTCCAGAGGAGCCATTCGAGCTAGCAGGATAGCAGCTGTTGCTGCAGATGCTCTCGTACCCCTTTCTGTCACTTCCACCTTGATTTTTTGAAAAGCTTCAGAAACATATAGTGGTTTTTCAGAGGACAAGCGGCTGAAGTCTGCCATCTCTTCAGTGAACATGTTAGTAATTCCCAGACGTTCTAGAGGCTTCTTCAGATCTACTTCACTAAGCAGAGAGAACTTGGGTAGGACTAGAAGTCGTGCTACTTTCTTCATTTGGGCTTTCCACTGGACAATGAGCTCAGATGTCAGGATGTTGGTGATGGTGGATAAGGGAACACCTTTTTCATAAGGAGCAGCAATAATCATGCTGAGCTCCTCTCCTTCATATGGCAGCTCTATCACATCATAAAAATCCCCATCTGGGGTTGTGAACTCACCGTAGTTGTATTTCCCAGTGTTGGCCATCATTTGGCACAATCCGTGAGACCCATCAAATCTGTAAAAATGGGCGCTGGTGTGTTGCCTTTCTCCGAAATGGGACAGTCCATATTGCCAGTGAAATGTATAACAACTTAATAATCAAAAAAAGGGTACAGTGAAAGGAATGTTTGTTGGTCCCCCCCAAAATCTTTAAAACATAAAAACCCGTTTTTTTTTTTTCCTAACCCATATGAATAAAAGAATTGTCCCTTTGTGCTTTTGGGGCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGCTCCATGACTTGTCCCA