ORFeome > serpinh1 ORF1 – XORFeome v1.0

serpinh1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: serpinh1
Gene ID: 1005108
Gene Page ID: 1005104
ORF Xenbase ID: 17295975

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124969
Original XGC clone length: 1404

Human orthology & disease relationships

NCBI Entrez ID: 871
Ensembl gene IDs: ENSG00000149257
Directly associated (OMIM) disease MIM numbers: 610504,613848
Indirectly associated (Lage, et al.) disease MIM numbers: 101600,104300,105120,108120,115200,123500,125853,131950,145980,182290,211980,215600,226650,226670,600652,603278,607841,609285

Library Location

Plate ID: GDExl11084
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ837330
dbEST ID: 79655032
Trimmed Sequence: ATGTGGATGATCAAGCTTCTAGCCCTCAGTATCCTCCTGGTTGTAGATGCAGCCGTAGACAAGAAGCCAGTAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAGAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGAGCTTCCAGCAGAGAAGAAGATGAGCCAACATGCAAATGTGCTTGCTGATAAGAGTGTAGGCCTGGCTTTCAACCTCTATCAAACCATGGCCAAGGACAAGAATGTGGAGAATATCCTTCTCTCTCCGGTAGTAGTTGCTTCTTCTCTTGGCCTGGTGAGTATGGGTGGACAAGCCAGCACCGCAGCCCAAGCTAAAGCCGTCCTTAGTGCGGACAAACTCAGTGATGAGCACATCCACTCCGGCCTTGCTGAGCTGCTCAACGAAGTGAGCAACTCCACTGCCCGCAACGTCACCTGGAAGATAGGGAACCGCCTGTATGGGCCCAGCTCCATCAGCTTCTCCGATGACTTTGTGAAAAACAGCAAGAAGCACTACAACTATGAGCACTCCAAGATCAACTTCAGAGACNAGAGAAGTACCTTGAGATCAATCAACGAATGGGCTTCCCAGAACACCGACGGCCAGCTGCCTGAGGTGACCAGCTTCCGTGGAGAAAACTGATGGGAGCTCTCATTGTCCAACGCTAATGTTTTTTCAACCCTCACTTGGGGATGGAACAAATTCCCCCCCAAC
Full Trace Sequence: GGGGGGCCCAAATAATAGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTGGATGATCAAGCTTCTAGCCCTCAGTATCCTCCTGGTTGTAGATGCAGCCGTAGACAAGAAGCCAGTAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGCGCCTCCAGCAGACAAGAAAGTGGCGCCTCCAGCAGACAAAAAAGTGGAGCTTCCAGCAGAGAAGAAGATGAGCCAACATGCAAATGTGCTTGCTGATAAGAGTGTAGGCCTGGCTTTCAACCTCTATCAAACCATGGCCAAGGACAAGAATGTGGAGAATATCCTTCTCTCTCCGGTAGTAGTTGCTTCTTCTCTTGGCCTGGTGAGTATGGGTGGACAAGCCAGCACCGCAGCCCAAGCTAAAGCCGTCCTTAGTGCGGACAAACTCAGTGATGAGCACATCCACTCCGGCCTTGCTGAGCTGCTCAACGAAGTGAGCAACTCCACTGCCCGCAACGTCACCTGGAAGATAGGGAACCGCCTGTATGGGCCCAGCTCCATCAGCTTCTCCGATGACTTTGTGAAAAACAGCAAGAAGCACTACAACTATGAGCACTCCAAGATCAACTTCAGAGACNAGAGAAGTACCTTGAGATCAATCAACGAATGGGCTTCCCAGAACACCGACGGCCAGCTGCCTGAGGTGACCAGCTTCCGTGGAGAAAACTGATGGGAGCTCTCATTGTCCAACGCTAATGTTTTTTCAACCCTCACTTGGGGATGGAACAAATTCCCCCCCAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGATGATCAAGCTTCTAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837329
dbEST ID: 79655031
Trimmed Sequence: TAATTCATCGCGTATTTTGTCTCCCTTCGGCCTCACGAGTCTGCCGATAAAGAGAATAGAATCTGTCTTCTTGTCCTTGATGAGGAAGATGAAGGGATGGTCGACGTAGAAGAGCTTGGGTGACCTGAGCTCCTCTCGGCTGTAGATATCAGAATCAAATGGATTTCCCTCTGTGTCCCACTCCAGGGCAGCGGCGTGGAACATGCTGGCCAAATAGAGGTCCTTCTTGCCGGAGATTTTGGAAAGGTCGGCTTTGGATTTGTCAATGGCCTCAGTCAGACCAAGGTCACCCAGATGTTTCTGAAGATCATGGCTGACTTCCAAGCTGACTTTAGGAAGAGACACAGCCACCGCTCTCGTCTTCATCTTTCCAACCCAACCATTGACGTTTTCTCTTGTCAAAAGCTTCTCTACCCTCTCCAAGGGCTCCACATGGTGGGGCATGATGAAGATCATGCTGGAGAGCTTATGCGCTAGTGGCATCTCCAGGATCTGGAGGCTATTTGTCTCATCATCAATGTAGTTGTACAGCCCTGTGCGGTGCATCATGGGGACAGACACAGTGAAAGGAACGGGTAACCATGAAACCCACGTTTGTCAACCATCTGATGGTGGAATCGTTCATCCCAGTTGAGGTTTGAAAAACATAACATTTGACAATGAAAAGCTCCCTCATTCCTCTTCCACGGGGCCTGGGTCACCTCAGGCAGCCTTTGGCCTTCCGGTGGGTCTGGGGGAAGCCCAATTTCCTTTTAATTGAATTTTCACAAGG
Full Trace Sequence: AAACAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAATTCATCGCGTATTTTGTCTCCCTTCGGCCTCACGAGTCTGCCGATAAAGAGAATAGAATCTGTCTTCTTGTCCTTGATGAGGAAGATGAAGGGATGGTCGACGTAGAAGAGCTTGGGTGACCTGAGCTCCTCTCGGCTGTAGATATCAGAATCAAATGGATTTCCCTCTGTGTCCCACTCCAGGGCAGCGGCGTGGAACATGCTGGCCAAATAGAGGTCCTTCTTGCCGGAGATTTTGGAAAGGTCGGCTTTGGATTTGTCAATGGCCTCAGTCAGACCAAGGTCACCCAGATGTTTCTGAAGATCATGGCTGACTTCCAAGCTGACTTTAGGAAGAGACACAGCCACCGCTCTCGTCTTCATCTTTCCAACCCAACCATTGACGTTTTCTCTTGTCAAAAGCTTCTCTACCCTCTCCAAGGGCTCCACATGGTGGGGCATGATGAAGATCATGCTGGAGAGCTTATGCGCTAGTGGCATCTCCAGGATCTGGAGGCTATTTGTCTCATCATCAATGTAGTTGTACAGCCCTGTGCGGTGCATCATGGGGACAGACACAGTGAAAGGAACGGGTAACCATGAAACCCACGTTTGTCAACCATCTGATGGTGGAATCGTTCATCCCAGTTGAGGTTTGAAAAACATAACATTTGACAATGAAAAGCTCCCTCATTCCTCTTCCACGGGGCCTGGGTCACCTCAGGCAGCCTTTGGCCTTCCGGTGGGTCTGGGGGAAGCCCAATTTCCTTTTAATTGAATTTTCACAAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATTCATCGCGTATTTTGTCTCC