ORFeome > sertad2 ORF1 – XORFeome v1.0

sertad2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sertad2
Gene ID: 5772334
Gene Page ID: 5772328
ORF Xenbase ID: 17295987

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106419
Original XGC clone length: 954

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: A05

Sequences - 5ʹ (forward) EST

Accession: JZ837975
dbEST ID: 79655677
Trimmed Sequence: ATGTTGGCTAAAGCAGGAAAGCGAAAGTTTGATGAGCATGAAGATGGGATGGAAGGCAAAGTGGTGTCCCCAACAGACGGACCATCCAAAGTGTCCTACACGTTACAGCGCCAGACTATTTTCAACATTTCCCTTATGAAACTCTATAACCACAGGCCGCTGACCGAGCCACGCTTACAAAGAACAGTTTTAATCAACAACATGTTGAGGCGAATACAGGATGAAATGAAGCAAGAAGGTAGTTTGAGGCCTGTGTTTATCAGCACTCCTCAGTCTACAGACCCTCTTGGTGACACCTATCAGGAGGCACAGCCTGCATTCAGCCATCTTGCCCCTCCTCCGGTTCAACCTAATGACTTACTAAGCACTACACCACTAGAGTCTTGCCTCACCCCAGCATCTTTGCTTGAGGAGGACACGTTTTGCACTTCTCAGACAACTCAGCAGAATGGTCCGAGCATCAGACTACCACCACCAACACCTCCTCCACCCCCTATCCAGCCCGTAAAGGACAGTTTCTCTTCAGCTTTGGATGAGATTGAGGAATTATGTCCAACATCTACCTCCACAAAGGCAGCTGCAACAAAAGAAGCAACGGCACAAGTAAATGATGATACTGCTGCAGCCAGTACCCACAAGCCAGAAGGAAAGCAAAAAAAACAAAACAAATGAGCCAAAGCCAATGAATTTCCCTTCCCGGGAATTTTTGAATTAACAAATCCACCGGGCCTTCCTTTACGGACTTACCCCTTGGAATAAAATTCCCCTTTTCCCGAAAATTTGAAAACTTCCATTTTTATAAATTTTGGAATCCCTTGTGCCCAC
Full Trace Sequence: TCGGGGCCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGGCTAAAGCAGGAAAGCGAAAGTTTGATGAGCATGAAGATGGGATGGAAGGCAAAGTGGTGTCCCCAACAGACGGACCATCCAAAGTGTCCTACACGTTACAGCGCCAGACTATTTTCAACATTTCCCTTATGAAACTCTATAACCACAGGCCGCTGACCGAGCCACGCTTACAAAGAACAGTTTTAATCAACAACATGTTGAGGCGAATACAGGATGAAATGAAGCAAGAAGGTAGTTTGAGGCCTGTGTTTATCAGCACTCCTCAGTCTACAGACCCTCTTGGTGACACCTATCAGGAGGCACAGCCTGCATTCAGCCATCTTGCCCCTCCTCCGGTTCAACCTAATGACTTACTAAGCACTACACCACTAGAGTCTTGCCTCACCCCAGCATCTTTGCTTGAGGAGGACACGTTTTGCACTTCTCAGACAACTCAGCAGAATGGTCCGAGCATCAGACTACCACCACCAACACCTCCTCCACCCCCTATCCAGCCCGTAAAGGACAGTTTCTCTTCAGCTTTGGATGAGATTGAGGAATTATGTCCAACATCTACCTCCACAAAGGCAGCTGCAACAAAAGAAGCAACGGCACAAGTAAATGATGATACTGCTGCAGCCAGTACCCACAAGCCAGAAGGAAAGCAAAAAAAACAAAACAAATGAGCCAAAGCCAATGAATTTCCCTTCCCGGGAATTTTTGAATTAACAAATCCACCGGGCCTTCCTTTACGGACTTACCCCTTGGAATAAAATTCCCCTTTTCCCGAAAATTTGAAAACTTCCATTTTTATAAATTTTGGAATCCCTTGTGCCCAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGCTAAAGCAGGAAAGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837974
dbEST ID: 79655676
Trimmed Sequence: GGAGCCAACCAGAACCTCCATGATATGATCTAATTCCGTGAGGTCAATTTTAAAAGGCTGACTTGGGGCTACTGGTTGGCTGCTATAAGGAGATAATGTTTTCAGAAGCTCATCTGGAGCCATCTTAGAGGCTGTTCCAGCATTGGATGTGCAAGGATCAAAATCATACATGGATGTATCAATATCAGAAAAGAGAATATCATCCAAGGTTAAGTCAGTAAGAAAGCCAGTGGATGTTGTTAATTCAAAATTTCCTGGAAGGGAATCCATTGGTTTTGGCTCACTTGTTCGGCTCTCTTGTGTTCCCTCTGGCTTGTGGGTACTAGCTGCAGCAGTATCATCATTTACATGTGCCGTTGCTTCTTCTGTTGCAGCTGCCTCTGTGGAGGTAGATGTTGGACATAATTCCTCAATCTCATCCAAAGCTGAACAGAAACTGTCCTTTACTGTCTGGAGAGGGGGTGGGAGAAGGGGTGGGGGGTGGGTTGGGACAACCAAGGAGAAATAGCACACCAACTCCCACCGCGCAGGAGGCGGGCGGAAAAGGAGCCGCCTCNGGGCTGGAGGGGTGGAGGGACGCGGGAACACCCGCCACGCGGGAGGCGGAAGGAAAAAATAATGAGGGAGAAAAGGAGGGGGGGGANNAAGGACGGCGCGGGGGGGGGGGGGTAATAACGAAGGGGCAAACCCCGGGGTGGGATTTGGAGACCGGGGGGGGGGAGGGGGGGGGAAGGCGCCCTAAAAATGGGGATCGAAAAAAGTTTTCCTAATGAGTATATG
Full Trace Sequence: AAACAGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGAGCCAACCAGAACCTCCATGATATGATCTAATTCCGTGAGGTCAATTTTAAAAGGCTGACTTGGGGCTACTGGTTGGCTGCTATAAGGAGATAATGTTTTCAGAAGCTCATCTGGAGCCATCTTAGAGGCTGTTCCAGCATTGGATGTGCAAGGATCAAAATCATACATGGATGTATCAATATCAGAAAAGAGAATATCATCCAAGGTTAAGTCAGTAAGAAAGCCAGTGGATGTTGTTAATTCAAAATTTCCTGGAAGGGAATCCATTGGTTTTGGCTCACTTGTTCGGCTCTCTTGTGTTCCCTCTGGCTTGTGGGTACTAGCTGCAGCAGTATCATCATTTACATGTGCCGTTGCTTCTTCTGTTGCAGCTGCCTCTGTGGAGGTAGATGTTGGACATAATTCCTCAATCTCATCCAAAGCTGAACAGAAACTGTCCTTTACTGTCTGGAGAGGGGGTGGGAGAAGGGGTGGGGGGTGGGTTGGGACAACCAAGGAGAAATAGCACACCAACTCCCACCGCGCAGGAGGCGGGCGGAAAAGGAGCCGCCTCNGGGCTGGAGGGGTGGAGGGACGCGGGAACACCCGCCACGCGGGAGGCGGAAGGAAAAAATAATGAGGGAGAAAAGGAGGGGGGGGANNAAGGACGGCGCGGGGGGGGGGGGGTAATAACGAAGGGGCAAACCCCGGGGTGGGATTTGGAGACCGGGGGGGGGGAGGGGGGGGGAAGGCGCCCTAAAAATGGGGATCGAAAAAAGTTTTCCTAATGAGTATATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGCCAACCAGAACCTCCA