ORFeome > sesn1 ORF1 – XORFeome v1.0

sesn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sesn1
Gene ID: 866080
Gene Page ID: 491635
ORF Xenbase ID: 17295993

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056061
Original XGC clone length: 1446

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11019
Well Location: E10

Sequences - 5ʹ (forward) EST

Accession: JZ824601
dbEST ID: 79642303
Trimmed Sequence: ATGAGGTTATCTCCCCGGGCAGCTCTCTCATCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGGCCACTAGGACAAGGGCCCAGTAGATTTGTTCCAGAAGAAGAGATTCTGCAGCTGGCAAGTGAGGATGCAAATATGCATTCTGTGTTTGCCGACGCTTTCACAGATTTGGGCCGTTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGAGAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGACGGACCCCTCTCACCCTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTGAACAAGATGCTAGCACATAGGCCGTGGCTCATCACAAAAGAGCACATTAAGCAATTGCTAAAAGCTGGGGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCTCACTATCACTCTTTAGCCTCTTTCACATTCGGTTGTGGAATTAACCCAGAAATACACAGTAATGGTGGCCACACCTTCCNGCCCTCATCTGTCAGCAACTACTGTATATGTGACATTACAATGGGAATCATGGGGACTGAAGTCATCTTCCTGGTTGGAATTGTGATGCCCACGGACTCCCCTTGGGAGGTCCAACCTTTTAGGGTAAAATGAACCACCTCCAAAAAGGCCAAAAAAAAAAAACCAAGTCAAAAAAAG
Full Trace Sequence: TTGTTTTAGAACTGGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGTTATCTCCCCGGGCAGCTCTCTCATCTCCAGAGATCATTTGCAGCCGCTGCAGCCAGTCCTGTAACAACAAGGAACTAGGAATCCGAATTCCACGGCCACTAGGACAAGGGCCCAGTAGATTTGTTCCAGAAGAAGAGATTCTGCAGCTGGCAAGTGAGGATGCAAATATGCATTCTGTGTTTGCCGACGCTTTCACAGATTTGGGCCGTTTAGACAACATTACCCTAGTGATGGTATTTCACCCTCAGTACTTGGAGAGCTTTCTGAAGACTCAGCATTACTTGCTGCAAATGGACGGACCCCTCTCACCCTGTTATCAGCACTACATTGGCATCATGGCAGCATCTAGGCATCAGTGTTCCTATCTTGTTAATCTTCATGTCAATGACTTTATTCATCATGGAGGGGACCAAAAGTGGTTAAATGGCTTGGAGAATGCCCCCCAAAAGCTGCGTAACCTTGGGGAGCTGAACAAGATGCTAGCACATAGGCCGTGGCTCATCACAAAAGAGCACATTAAGCAATTGCTAAAAGCTGGGGAACACAGCTGGTCTTTGGCAGAATTAATTCATGCAATCGTTCTTCTGGCTCACTATCACTCTTTAGCCTCTTTCACATTCGGTTGTGGAATTAACCCAGAAATACACAGTAATGGTGGCCACACCTTCCNGCCCTCATCTGTCAGCAACTACTGTATATGTGACATTACAATGGGAATCATGGGGACTGAAGTCATCTTCCTGGTTGGAATTGTGATGCCCACGGACTCCCCTTGGGAGGTCCAACCTTTTAGGGTAAAATGAACCACCTCCAAAAAGGCCAAAAAAAAAAAACCAAGTCAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTTATCTCCCCGGGCA

Sequences - 3ʹ (reverse) EST

Accession: JZ829951
dbEST ID: 79647653
Trimmed Sequence: GGTCATATATCGAGTAATTGCTCTCAGAGCATAAAGCAGTTCTCCCTGCATCCTCGCTTCCATAAGAAGCAAATTTACATGTACTTTTTCAGAGTGCTTAAATTGTCTCCAAAAACCATCATACATTCTCTTTGACGTTTTCTCAGGACTGCACACCACATTTTTAATGTAAACCTTGAAGCTGCGATCCAGTAGCTGGTTGATTTCTCCATAATCATAGTCATCATATCTTATACCAAACATGCAGTGAACATAATTCCATACTGCGCGTCTTAAAGTTGAAGTATCCACATCTTTATGCATTGCCATGGTATTATAAGTCAGGTTGTAAGCAATGTGGAACTTCTCATCTAATAGCTGCCCGACATCTGGATACAGGCGATTAACTAGTGAATAGCCGTGATCTTCCCAGCTGTAATCCTGCACTCGAAAAGTAGGCACATGCATCCCTCGTCTGGAGAAGTCTTTGTAACCATAGCTTGTATCTTCAAAATGCCGGGAAACATCTATATCCGGGGGGAGGGTCTTCATCTTCTGTAGAANACACCATGCTTTCAGTTTTCTCTCTCTCAAAACGAGTTGCCATCTCTTCTTGACTTGCTTCTTCTTCATCTCTGCCTTCTTGAAGTTGCTTCATCTTCACCATCAAAGCTTCGACCTCCACAAGTGGGAGTCTGTAGGCATCACAATTCCAACAAGGAAGATGACCTTCCATTCCCCTGGAATGGCCCTTTGGTAAGGTCCACATAATACCGTAATTTGCTGACAAAAG
Full Trace Sequence: ACGAGTAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGGTCATATATCGAGTAATTGCTCTCAGAGCATAAAGCAGTTCTCCCTGCATCCTCGCTTCCATAAGAAGCAAATTTACATGTACTTTTTCAGAGTGCTTAAATTGTCTCCAAAAACCATCATACATTCTCTTTGACGTTTTCTCAGGACTGCACACCACATTTTTAATGTAAACCTTGAAGCTGCGATCCAGTAGCTGGTTGATTTCTCCATAATCATAGTCATCATATCTTATACCAAACATGCAGTGAACATAATTCCATACTGCGCGTCTTAAAGTTGAAGTATCCACATCTTTATGCATTGCCATGGTATTATAAGTCAGGTTGTAAGCAATGTGGAACTTCTCATCTAATAGCTGCCCGACATCTGGATACAGGCGATTAACTAGTGAATAGCCGTGATCTTCCCAGCTGTAATCCTGCACTCGAAAAGTAGGCACATGCATCCCTCGTCTGGAGAAGTCTTTGTAACCATAGCTTGTATCTTCAAAATGCCGGGAAACATCTATATCCGGGGGGAGGGTCTTCATCTTCTGTAGAANACACCATGCTTTCAGTTTTCTCTCTCTCAAAACGAGTTGCCATCTCTTCTTGACTTGCTTCTTCTTCATCTCTGCCTTCTTGAAGTTGCTTCATCTTCACCATCAAAGCTTCGACCTCCACAAGTGGGAGTCTGTAGGCATCACAATTCCAACAAGGAAGATGACCTTCCATTCCCCTGGAATGGCCCTTTGGTAAGGTCCACATAATACCGTAATTTGCTGACAAAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTCATATATCGAGTAATTGCTCT