ORFeome > set ORF1 – XORFeome v1.0

set ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: set
Gene ID: 986878
Gene Page ID: 986871
ORF Xenbase ID: 17296017

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC056839
Original XGC clone length: 837

Human orthology & disease relationships

NCBI Entrez ID: 6418
Ensembl gene IDs: ENSG00000119335
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114500,114550,125853,132600,155255,600652,603278,607841,608615

Library Location

Plate ID: GDExl11003
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ839461
dbEST ID: 79657163
Trimmed Sequence: ATGTCGGCGCCCAAAGTCAGTAAAAAGGAGGTGAACTCCAACCATGACGGAGCGGACGAGACCTCAGAAAAAGAGCAACAGGAAGCCATTGAGCATATTGATGAAGTACAGAATGAAACAGACAGACTGAACGAACAGGCAAGTGAAGAAATATTGAAAGTAGAACAGAAATATAACAAACTTCGTCAGCCATTTTTCCAGAAGAGGTCAGAGTTGATCGCCAAAATCCCAAACTTCTGGGTTACAACATTCGTCAACCACCCACAAGTATCAGCATTACTGGGTGAGGAAGATGAAGAAGCACTTCACTATCTGACTCGGGTGGAGGTTACAGAGTTTGAAGACATAAAATCGGGTTACAGAATAGATTTTTATTTTGATGAGAATCCCTACTTTGAAAACAAAGTCCTCTCTAAAGAATTCTACTTGAATGAAAGTGGAGACCCATCTTCAAAGTCAACTGAGCTAAAATGGAAAGCAGGCAAGGATTTAACAAAGCGTTCTAGCCAGACACAGAACAAAGCCAGCAGGAAGAGGCAACATGAAGAGCCAGAAAGCTTTTTCACTTGGTTCACAGATCATTCTGATGCAGGGGCTGATGAACTTGGAGAGGTTATTAAGGATGACATCTGGCCAAACCCACTGCAGTACTACCTGGTCCTTGACATGGAAGATGAGGAAACGAGGGGTGAGGAAGAGGGATGATGACAATTAAGGAAGAGAAGGGGCTAGAAATATTGATGAAGAAGGGGAAAGAAAAAGTAGGTTTTAAAGGAAAAGAAGAATAAAGAACAAAAAAAAGAAAAGGGGAAGAAAAAACCGGAAAGAAA
Full Trace Sequence: TCGAGGGCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGCGCCCAAAGTCAGTAAAAAGGAGGTGAACTCCAACCATGACGGAGCGGACGAGACCTCAGAAAAAGAGCAACAGGAAGCCATTGAGCATATTGATGAAGTACAGAATGAAACAGACAGACTGAACGAACAGGCAAGTGAAGAAATATTGAAAGTAGAACAGAAATATAACAAACTTCGTCAGCCATTTTTCCAGAAGAGGTCAGAGTTGATCGCCAAAATCCCAAACTTCTGGGTTACAACATTCGTCAACCACCCACAAGTATCAGCATTACTGGGTGAGGAAGATGAAGAAGCACTTCACTATCTGACTCGGGTGGAGGTTACAGAGTTTGAAGACATAAAATCGGGTTACAGAATAGATTTTTATTTTGATGAGAATCCCTACTTTGAAAACAAAGTCCTCTCTAAAGAATTCTACTTGAATGAAAGTGGAGACCCATCTTCAAAGTCAACTGAGCTAAAATGGAAAGCAGGCAAGGATTTAACAAAGCGTTCTAGCCAGACACAGAACAAAGCCAGCAGGAAGAGGCAACATGAAGAGCCAGAAAGCTTTTTCACTTGGTTCACAGATCATTCTGATGCAGGGGCTGATGAACTTGGAGAGGTTATTAAGGATGACATCTGGCCAAACCCACTGCAGTACTACCTGGTCCTTGACATGGAAGATGAGGAAACGAGGGGTGAGGAAGAGGGATGATGACAATTAAGGAAGAGAAGGGGCTAGAAATATTGATGAAGAAGGGGAAAGAAAAAGTAGGTTTTAAAGGAAAAGAAGAATAAAGAACAAAAAAAAGAAAAGGGGAAGAAAAAACCGGAAAGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGCGCCCAAAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ839460
dbEST ID: 79657162
Trimmed Sequence: ATCATCTTCACCTTCGTCTTCCTCCGCTTCTTCTCCCTCTTCATCTTCGTCATCATCTTCCTCTCCTTCAACCTCATCTTCATCCCCCTCCTCATCAATATCTTCTAGCCCCTCTTCTTCCTCATCGTCATCATCCTCTTCCTCACCCTCTGCTTCTTCATCTTCCATGTCAGGGACCAGGTAGTACTGCAGTGGGTTTGGCCAGATGTCATCCTTAATAACCTCTCCAAGTTCATCAGCCCCTGCATCAGAATGATCTGTGAACCAAGTGAAAAAGCTTTCTGGCTCTTCATGTTGCCTCTTCCTGCTGGCTTTGTTCTGTGTCTGGCTAGAACGCTTTGTTAAATCCTTGCCTGCTTTCCATTTTAGCTCAGTTGACTTTGAAGATGGGTCTCCACTTTCATTCAAGTAGAATTCTTTAGAGAGGACTTTGTTTTCAAAGTAGGGATTCTCATCAAAATAAAAATCTATTCTGTAACCCGATTTTATGTCTTCAAACTCTGTAACCTCCACCCGAGTCAGATAGTGAAGTGCTTCTTCATCTTCCTCACCCAGTAATGCTGATACTTGTGGGTGGTTGACGAATGTTGTAACCCAGAAGTTTTGGATTTTGGGCGACAACTCTGAACTCTTCCTGGAAATGGCGGGACAAGGTTGGTATATTTCGGTTCAACTTTAAATAATTTCTTCATTTTCCGGTCGTTTCGGGCGGGGCGTGTTCAATTCAGGACTTTCAGCCAAAATGCGGAGGGGGGCTTCCTGTTTGCCTTTTT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCATCTTCACCTTCGTCTTCCTCCGCTTCTTCTCCCTCTTCATCTTCGTCATCATCTTCCTCTCCTTCAACCTCATCTTCATCCCCCTCCTCATCAATATCTTCTAGCCCCTCTTCTTCCTCATCGTCATCATCCTCTTCCTCACCCTCTGCTTCTTCATCTTCCATGTCAGGGACCAGGTAGTACTGCAGTGGGTTTGGCCAGATGTCATCCTTAATAACCTCTCCAAGTTCATCAGCCCCTGCATCAGAATGATCTGTGAACCAAGTGAAAAAGCTTTCTGGCTCTTCATGTTGCCTCTTCCTGCTGGCTTTGTTCTGTGTCTGGCTAGAACGCTTTGTTAAATCCTTGCCTGCTTTCCATTTTAGCTCAGTTGACTTTGAAGATGGGTCTCCACTTTCATTCAAGTAGAATTCTTTAGAGAGGACTTTGTTTTCAAAGTAGGGATTCTCATCAAAATAAAAATCTATTCTGTAACCCGATTTTATGTCTTCAAACTCTGTAACCTCCACCCGAGTCAGATAGTGAAGTGCTTCTTCATCTTCCTCACCCAGTAATGCTGATACTTGTGGGTGGTTGACGAATGTTGTAACCCAGAAGTTTTGGATTTTGGGCGACAACTCTGAACTCTTCCTGGAAATGGCGGGACAAGGTTGGTATATTTCGGTTCAACTTTAAATAATTTCTTCATTTTCCGGTCGTTTCGGGCGGGGCGTGTTCAATTCAGGACTTTCAGCCAAAATGCGGAGGGGGGCTTCCTGTTTGCCTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCATCTTCACCTTCGTCTTCCT