ORFeome > setd4 ORF2 – XORFeome v1.0

setd4 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: setd4
Gene ID: 5772364
Gene Page ID: 5772356
ORF Xenbase ID: 17296035

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC108867
Original XGC clone length: 1371

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: D02

Sequences - 5ʹ (forward) EST

Accession: JZ837249
dbEST ID: 79654951
Trimmed Sequence: ATGAAATCCAAATGGGGAAGGACGGGGCGAAAGAGGAAAAGGAAAGGCCCATCTGGCACTAAATCCTATGCAGCCAATCGGAGCCATGAATGGCAGTACATCCAGCTGCAGAGGTGGCTGAAAGGGAGGGGGTTTCAAGGCAGGCACCTACAAGCTGCAAAGTTTGCAGACACTGGAAGAGGGTTGATGGCTACCAAAGACTTGAAGCCAGGGGAACTGATCATTGCACTGCCTGAAACCTGTCTGATCACTACAGAGACTGTTCTGCAAAGTTATCTTGGGAAATATATTAAACTATGGAGACCCCATGTTTCCCCACTGCTGGCCTTGTGCACGTTCCTGATTGCAGAAAGGTTTGCCGGAGAGCGTTCCCAGTGGAAGCCTTACCTGGATGTAATACCCAGCACCTACAGCTGCCCTGTTTATTGGGAGTTGGAAATAGTCCACCTGCTGCCTGCACCTCTCCGGCAAAAAGCTCTGGAGCAAAAAACAAAGGTCCAAGAGCTGCATACAGAATCGTTGGCTTTCTTCAACTCCTTGCAGCCCCTCTTTTGTGACAATGTACCAGATATATATACTTATGATGCCCTGCGCTGGGCCTGGTGCACTGTAACTACAAAGACCGTATACATGAACCACACCCAGCAAGACAGACTCCTGCCACAGCCGGACGTCTGTGCCTTGGCTCCGTCGTTAAACTGCTTAACCACGGCCCAAAAGTGCAAGGTGGAAGGCGGAATTCAGTAAAAACATAACCTTCCTACGAAATCCGGGAACAAAGAGCGGCGC
Full Trace Sequence: CGTGGGCCCACNATAATGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAATCCAAATGGGGAAGGACGGGGCGAAAGAGGAAAAGGAAAGGCCCATCTGGCACTAAATCCTATGCAGCCAATCGGAGCCATGAATGGCAGTACATCCAGCTGCAGAGGTGGCTGAAAGGGAGGGGGTTTCAAGGCAGGCACCTACAAGCTGCAAAGTTTGCAGACACTGGAAGAGGGTTGATGGCTACCAAAGACTTGAAGCCAGGGGAACTGATCATTGCACTGCCTGAAACCTGTCTGATCACTACAGAGACTGTTCTGCAAAGTTATCTTGGGAAATATATTAAACTATGGAGACCCCATGTTTCCCCACTGCTGGCCTTGTGCACGTTCCTGATTGCAGAAAGGTTTGCCGGAGAGCGTTCCCAGTGGAAGCCTTACCTGGATGTAATACCCAGCACCTACAGCTGCCCTGTTTATTGGGAGTTGGAAATAGTCCACCTGCTGCCTGCACCTCTCCGGCAAAAAGCTCTGGAGCAAAAAACAAAGGTCCAAGAGCTGCATACAGAATCGTTGGCTTTCTTCAACTCCTTGCAGCCCCTCTTTTGTGACAATGTACCAGATATATATACTTATGATGCCCTGCGCTGGGCCTGGTGCACTGTAACTACAAAGACCGTATACATGAACCACACCCAGCAAGACAGACTCCTGCCACAGCCGGACGTCTGTGCCTTGGCTCCGTCGTTAAACTGCTTAACCACGGCCCAAAAGTGCAAGGTGGAAGGCGGAATTCAGTAAAAACATAACCTTCCTACGAAATCCGGGAACAAAGAGCGGCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATCCAAATGGGGAAGGAC

Sequences - 3ʹ (reverse) EST

Accession: JZ837248
dbEST ID: 79654950
Trimmed Sequence: CTTCTGCTCTGTGAAACTACAGCTCCCAGCAGCCCCAGTGGGTCCTGCAGAGGGTTCATTCTGTAGCAGATTTGCAGATATGTGAAGAATCTTCTTCTCCTCCAGTCTCAGAGCTTCCACCAAAGCCAAGTGCACAGCGGCGTCAGCATCGGAGATCTTCTTGCTTCTCACAAGGGAAATCCCTTTAAGGGCACAGGAGGTTTCATCCAGCAAGCGGAAACAGATTTTTCTGACAAGTTCTCGGGAATCCTGCTCATTGGCATCGGAAATGAAACTTCCCAGAATGACTTTCTTCCAGCTCGTGAATTCCTCTGGCCTAAGGCACAGCAGCTTCACAGCAGTTAGGAGTTTCCAAGATGGACCCTCCAATCCGAACGTCAAATTTACTAGAAAGTCATGTTCCTTTAGCAAAGCCCATTTCTTTGGCATCTGCTTGTCCCCAGGAGACAAATGAGCAAGGATGGCATCTTTGGTCACATAAACGCTACGGTGCGGATTATTGGCCGCTACAAATCCATACTCTAGCAGGAGGCGCTGGTTATCGTGGGGCCCATACATATAAACACCTGGTCGTGTTTCCGGCAGCCGCTGTTGGTCCTGATCTCGTAACAGCGTCTGTCTTTAATTAAATCCGCTTCCCACTTGCACCTCTGGGCCTGGTGGTTTAACAAGGCTAAAATATTGAAACCCAAGGCGCAAAACATTCCTGCCTGGT
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTCTGCTCTGTGAAACTACAGCTCCCAGCAGCCCCAGTGGGTCCTGCAGAGGGTTCATTCTGTAGCAGATTTGCAGATATGTGAAGAATCTTCTTCTCCTCCAGTCTCAGAGCTTCCACCAAAGCCAAGTGCACAGCGGCGTCAGCATCGGAGATCTTCTTGCTTCTCACAAGGGAAATCCCTTTAAGGGCACAGGAGGTTTCATCCAGCAAGCGGAAACAGATTTTTCTGACAAGTTCTCGGGAATCCTGCTCATTGGCATCGGAAATGAAACTTCCCAGAATGACTTTCTTCCAGCTCGTGAATTCCTCTGGCCTAAGGCACAGCAGCTTCACAGCAGTTAGGAGTTTCCAAGATGGACCCTCCAATCCGAACGTCAAATTTACTAGAAAGTCATGTTCCTTTAGCAAAGCCCATTTCTTTGGCATCTGCTTGTCCCCAGGAGACAAATGAGCAAGGATGGCATCTTTGGTCACATAAACGCTACGGTGCGGATTATTGGCCGCTACAAATCCATACTCTAGCAGGAGGCGCTGGTTATCGTGGGGCCCATACATATAAACACCTGGTCGTGTTTCCGGCAGCCGCTGTTGGTCCTGATCTCGTAACAGCGTCTGTCTTTAATTAAATCCGCTTCCCACTTGCACCTCTGGGCCTGGTGGTTTAACAAGGCTAAAATATTGAAACCCAAGGCGCAAAACATTCCTGCCTGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTGCTCTGTGAAACTAC