ORFeome > setd8 ORF1 – XORFeome v1.0

setd8 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: setd8
Gene ID: 865841
Gene Page ID: 489176
ORF Xenbase ID: 17296047

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124952
Original XGC clone length: 1008

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: D05

Sequences - 5ʹ (forward) EST

Accession: JZ837338
dbEST ID: 79655040
Trimmed Sequence: ATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCAGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGATTACTGGGAAAGGGCGAGGTGTAATTGCAACTCGGGACTTCCAGGCGAGGAGAGTTTGGTTGTAGAAATACATGGGAGATCTGATAAGAGATCACGGATGCCCAAAAAGAAGAGAAGCATCAAAATGCACAGGGATTCCAGCTACTGGGCTGGCTTTGTGGTACCTATTTTTCAGTATTTTTAAAACAAAAACCTACGTGCCATCCAATTCCCA
Full Trace Sequence: CGAGGGCCCCAATAATGGATTTTANTTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGAAGAGGGAAGAAAATGTCCAAACCCGGCGACGGAAGGAGCGGGGACGTCTCGGATACCGGCAGGAACGGCGGCACCAATGAAAATCATCCAAAAACGAACGGGGAGGTGGTTCATTGTGGGCAGGCCAAAATCTACTCTTATATGAGCCCAACTAAATCTCCCAGTGCCCGCCCTCCCCTGCAAGAAGAAAACTCTGTTACGCACCATGAGAGCAAGTGTCTGGGGAAACCCTCAACAGAGACTCGCAAAAAAGCAGAGGTTGAGAAAAAGAAAATATTGTCAACAGAACTGTCGGTGAAACCCAGTGAGCAAAGGGAGACTGAATGCAATTCTATAGGAGAGTTTCTTGAGCCAAAACTAGAGCTGAATGATGTACAGAGAAACCTAGCATTGCCACCTGAAGACAAGCTGCAATCTCAAAAGATGGTTAAAAACAAACCTCTAAGAAAGAAGACTCAAAGGCAGAAATCTCCAAATAGAAAACTTACTGATTATTACCCTGTGAGAAGAAGCAGCAGGAAGAATAAAACAGAAATTGAGTCAGAGGAGAAGAAGAGAATAGATGAACTAATTCAGACTGGCAAAGAAGAAGGGATAAAGATGCACATGATTACTGGGAAAGGGCGAGGTGTAATTGCAACTCGGGACTTCCAGGCGAGGAGAGTTTGGTTGTAGAAATACATGGGAGATCTGATAAGAGATCACGGATGCCCAAAAAGAAGAGAAGCATCAAAATGCACAGGGATTCCAGCTACTGGGCTGGCTTTGTGGTACCTATTTTTCAGTATTTTTAAAACAAAAACCTACGTGCCATCCAATTCCCA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAGAGGGAAGAAAATG

Sequences - 3ʹ (reverse) EST

Accession: JZ837337
dbEST ID: 79655039
Trimmed Sequence: GTTTTTAAGCCAAGGATGTGCATCAATGGAAGATTTTCTTCTATCACCATAGTCATACAGCAATTCCTCTCCAACGTTGATATCCCGCGATGCAACAAGTATAAGGTGAGGTACATTGTTGATGTTGTGCAGTTTGGTGTGACAGTTTCCAGACTTGCTGTGGTTGATCAGCCTCCCTAAACGGCCAGTCTCTCTTGTGGCATCGATGCAGTAGCTTGTGTTCAAATACTGAAAATAGTACATATAGCAGCCAGTAGCTGAATCCTGTGCATATGATGCTTCTCTCCTTTTGGCATCCGTGATCTCTATCAGATCTCCATGGTATTCTACAACAAACTCTCCTCGCTGGAAGTCCCGAGTTGCAATTACACCTCGCCCTTTCCCAGTAATCATGTGCATCTTTATCCCTTCTTCTTTGCCAGTCTGAATTAGTTCATCTATTCTCTTCTTCTCCTCTGACTCAATTTCTGTTTTATTCTTCCTGCTGCTTCTTCTCACAGGGTAATAATCAGTAAGTTTTCTATTTGGAGATTTCTGCCTTTGAGTCTTCTTTCTTAAAGGTTTGTTTTTAACCATCTTTTGAGATTGCAGCTTGTCTTCAGGTGGCAATGCTAGGTTTCTGTGAGCTTCTTCAGGCTCTAGTTTGGCTTAAGAAAATGGTCAAAAAAAATGCAATCAGTCCTCCCTTTGCCTCCCGGGTTTGCGCCGAACGGGTTTTTTTAAAATTAATTTTTTTTTTTCCTAACCCTCTTCCCTTTCTTCTCAAACTC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTTTAAGCCAAGGATGTGCATCAATGGAAGATTTTCTTCTATCACCATAGTCATACAGCAATTCCTCTCCAACGTTGATATCCCGCGATGCAACAAGTATAAGGTGAGGTACATTGTTGATGTTGTGCAGTTTGGTGTGACAGTTTCCAGACTTGCTGTGGTTGATCAGCCTCCCTAAACGGCCAGTCTCTCTTGTGGCATCGATGCAGTAGCTTGTGTTCAAATACTGAAAATAGTACATATAGCAGCCAGTAGCTGAATCCTGTGCATATGATGCTTCTCTCCTTTTGGCATCCGTGATCTCTATCAGATCTCCATGGTATTCTACAACAAACTCTCCTCGCTGGAAGTCCCGAGTTGCAATTACACCTCGCCCTTTCCCAGTAATCATGTGCATCTTTATCCCTTCTTCTTTGCCAGTCTGAATTAGTTCATCTATTCTCTTCTTCTCCTCTGACTCAATTTCTGTTTTATTCTTCCTGCTGCTTCTTCTCACAGGGTAATAATCAGTAAGTTTTCTATTTGGAGATTTCTGCCTTTGAGTCTTCTTTCTTAAAGGTTTGTTTTTAACCATCTTTTGAGATTGCAGCTTGTCTTCAGGTGGCAATGCTAGGTTTCTGTGAGCTTCTTCAGGCTCTAGTTTGGCTTAAGAAAATGGTCAAAAAAAATGCAATCAGTCCTCCCTTTGCCTCCCGGGTTTGCGCCGAACGGGTTTTTTTAAAATTAATTTTTTTTTTTCCTAACCCTCTTCCCTTTCTTCTCAAACTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTTAAGCCAAGGATGTGC