ORFeome > sf3b1 ORF1 – XORFeome v1.0

sf3b1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sf3b1
Gene ID: 959871
Gene Page ID: 959866
ORF Xenbase ID: 17296077

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097718
Original XGC clone length: 2445

Human orthology & disease relationships

NCBI Entrez ID: 23451
Ensembl gene IDs: ENSG00000115524
Directly associated (OMIM) disease MIM numbers: 614286
Indirectly associated (Lage, et al.) disease MIM numbers: 148700,162210,164300,193520,214450,256710,300590,303600,609065,609227

Library Location

Plate ID: GDExl11082
Well Location: G01

Sequences - 5ʹ (forward) EST

Accession: JZ837114
dbEST ID: 79654816
Trimmed Sequence: ATGGCGAAAGTTGCGAAAACACACGAAGATATTGAAGCACAAATACGTGAAATTCAAGGGAAGAAGGCAGCCCTCGATGAGGAAGAAGGAGTTGGACTTGATTCTACTGGATATTTTGATCAAGAAATTTATGGTGGAAGTGATAGCAGATTTACTGGATATGTCACATCTATCGCAGCAAATGAACAAGAAGATGACGATGATGATGTTTCTTCAGCAACTTTTGAACAGAAGAAACCAGGTTATCACGCTCCAGTTGCATTATTAAATGATATCCCTCAGTCCACTGAACAGTATGATCCGTTTGCAGAACACAGACCGCAGAAGATTGCAAACCGTGAAGATGAGTATAAACAGCAGAGAAGAAAGATGATTATTTCTCCTGAAAGGCTTGATCCTTTTGCAGATGGTGGAAAAACACCAGATCCTAAATTAAATGCAAGAACCTTCAAAGATGTTATGCAAGAACAATATTTAACAAAGGAAGAGCGTGAAATACGACAACAAATAGCAGAAAAGGCTAAATCTGGAGATCTTAAAGTGGTTAATGGATCATCTGCATCGTCTGCAGCACAGCCACCTTCTAAACGCAAACGTAGATGGGATCAGACAGGGGATCAGACGCCAGGTTCTACTCAAAGAAACTATCGAGTTGGGATCAAGCGGAGGTCACTCCTGGACACACACCTTCCTCATTAAAATGGGATGAAACGGCAGGGCGGGCAAAAGGAAATGAAACTCTTGGAGCACCCCCGGGTTCCAAAAATTTGGGAATCTACCCCCAAGCTCAACCTCCACCTGGGATTTTCTTCCCCCTTGGCAAAAGGGGAAAAATCCCGGGG
Full Trace Sequence: GACACCATATAAGTGGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGAAAGTTGCGAAAACACACGAAGATATTGAAGCACAAATACGTGAAATTCAAGGGAAGAAGGCAGCCCTCGATGAGGAAGAAGGAGTTGGACTTGATTCTACTGGATATTTTGATCAAGAAATTTATGGTGGAAGTGATAGCAGATTTACTGGATATGTCACATCTATCGCAGCAAATGAACAAGAAGATGACGATGATGATGTTTCTTCAGCAACTTTTGAACAGAAGAAACCAGGTTATCACGCTCCAGTTGCATTATTAAATGATATCCCTCAGTCCACTGAACAGTATGATCCGTTTGCAGAACACAGACCGCAGAAGATTGCAAACCGTGAAGATGAGTATAAACAGCAGAGAAGAAAGATGATTATTTCTCCTGAAAGGCTTGATCCTTTTGCAGATGGTGGAAAAACACCAGATCCTAAATTAAATGCAAGAACCTTCAAAGATGTTATGCAAGAACAATATTTAACAAAGGAAGAGCGTGAAATACGACAACAAATAGCAGAAAAGGCTAAATCTGGAGATCTTAAAGTGGTTAATGGATCATCTGCATCGTCTGCAGCACAGCCACCTTCTAAACGCAAACGTAGATGGGATCAGACAGGGGATCAGACGCCAGGTTCTACTCAAAGAAACTATCGAGTTGGGATCAAGCGGAGGTCACTCCTGGACACACACCTTCCTCATTAAAATGGGATGAAACGGCAGGGCGGGCAAAAGGAAATGAAACTCTTGGAGCACCCCCGGGTTCCAAAAATTTGGGAATCTACCCCCAAGCTCAACCTCCACCTGGGATTTTCTTCCCCCTTGGCAAAAGGGGAAAAATCCCGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAAAGTTGCGAAAACA

Sequences - 3ʹ (reverse) EST

Accession: JZ837113
dbEST ID: 79654815
Trimmed Sequence: GAGAATTTCTGTCTTGATGTAATTTGCTTCTACTCCATCAGTCCCACAACACTGTTTAACCACCTTTAGCACGATTTTCTTCATTTCTTCATCTGGGGACTGGAATTCTCTAATCAAAATTAACATTACTTCTCGAGTGTAGTAGTTTGCATATTCTGCATCCATAAGAGGAATCAGATAGCCAATAGCCTTCAAAAAGGCAGCAAGACCCTTTCCTCTGTGTTGTCGAATTCCTTTCCAAAGAGGTTTTAGCACTGAATCAAATGATTCAATTCCATAAGGAGTAGCTGCCTCTGCCAAAGCAGCAATAGCCAGAGCACTGATGGTGCGGACTTTCTGTTGCTCATCAACCAAACCATGTTCAATAATTTCCACCAAACTTCTTAGATGTGGCAAAATAGCACATCCCATCAGAATGGCAATTTGCTGCACAATTTTAATTCCAGTATGACGAGCCTGCCAAGACTTTTTGCTTTTGCATACTGCTTTCAAAAAAGGAAGCAAAGATGGAATACCAAGGGCAGAGGCAACAACAGCAAAGGCTCGAGCTGTTGTATTACGGACGTATTCATCCATGTTATCAATATCTGGTCGCATAGTTGAAATCATTGTAGCTAAACCAGCAGCCCTGGCTAAATTTAGATATGATTTCTCTGCCTTTCACTCCTGGCATAATAGTCCTCCTCCATTCAAAAATGGGTTCAATAACCAACCAAAAAACCTAATGTAAAAAAATGGGCGGGAACAAAGTCCCCCCCCATTTTTTTAACCAAA
Full Trace Sequence: GAAAAAGTCTAATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAGAATTTCTGTCTTGATGTAATTTGCTTCTACTCCATCAGTCCCACAACACTGTTTAACCACCTTTAGCACGATTTTCTTCATTTCTTCATCTGGGGACTGGAATTCTCTAATCAAAATTAACATTACTTCTCGAGTGTAGTAGTTTGCATATTCTGCATCCATAAGAGGAATCAGATAGCCAATAGCCTTCAAAAAGGCAGCAAGACCCTTTCCTCTGTGTTGTCGAATTCCTTTCCAAAGAGGTTTTAGCACTGAATCAAATGATTCAATTCCATAAGGAGTAGCTGCCTCTGCCAAAGCAGCAATAGCCAGAGCACTGATGGTGCGGACTTTCTGTTGCTCATCAACCAAACCATGTTCAATAATTTCCACCAAACTTCTTAGATGTGGCAAAATAGCACATCCCATCAGAATGGCAATTTGCTGCACAATTTTAATTCCAGTATGACGAGCCTGCCAAGACTTTTTGCTTTTGCATACTGCTTTCAAAAAAGGAAGCAAAGATGGAATACCAAGGGCAGAGGCAACAACAGCAAAGGCTCGAGCTGTTGTATTACGGACGTATTCATCCATGTTATCAATATCTGGTCGCATAGTTGAAATCATTGTAGCTAAACCAGCAGCCCTGGCTAAATTTAGATATGATTTCTCTGCCTTTCACTCCTGGCATAATAGTCCTCCTCCATTCAAAAATGGGTTCAATAACCAACCAAAAAACCTAATGTAAAAAAATGGGCGGGAACAAAGTCCCCCCCCATTTTTTTAACCAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAGAATTTCTGTCTTGATGT