ORFeome > sfrpx ORF1 – XORFeome v1.0

sfrpx ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sfrpx
Gene ID: 6256139
Gene Page ID: 495295
ORF Xenbase ID: 17296119

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123152
Original XGC clone length: 867

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11088
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ838196
dbEST ID: 79655898
Trimmed Sequence: ATGAGGTTCCTCCTATGCGTCTCTGTGTTCCTGGGAGTCGTGGGCCCCACACAGGCCTTACCCTTCATCCTCACCCATCTGAGTACCCGCAAGAGCAGCTGCAAATCCATCCCCGGCACTATGACCCTGTGCCACGGCGTGGGCTACACTGAGATGCGCCTGCCCAACCTGCTGGGACACGACACTATGAAGGAGGCTCTGCAGCAGGCGGGTTCCTGGGTGCCACTCCTTTCTAAACAGTGCCACGCAAACACCAAGAAGTTCCTCTGTTCTCTATTTGCCCCCGTGTGTTTGAGTGAACTAGATCAGGCCGTGTACCCCTGCAGGTCCCTCTGTGAGGCAGTGCGAGACGGCTGCACCCCCGTCATGTCTGCATTTGGCTTCCCCTGGCCTGATATGTTCAACTGCACCCAGTTTCCCCTGGGGAATGAGCTGTGTGTGCCCCCTGCTGGCAGTGAGGATAAACAACAAGAGCTTAAAGAGGAGGTGCCCTGCTCCGCCTGCCGTAACCGGGGTGACCCACACAAGGATTTCCTACAGAATTACTGCTCTTCTGATTTTGCTCTGAAGATGAACATCCCCTCAGTGTCCACCCTGGAAGGAGAAATCATGATGGGTTCCAGAATTTAAAAGCCAGGAACAGTGTATAAAAAACAAGGCCTGGAGTGGAGAATAAACTGAAAAAAAAAACTACCTCTGGGCGCCCAAATGGAAAACAAACTGGCCCCGCCCCCGGAAATTTCTTGAACCC
Full Trace Sequence: CTCGAGGCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGGTTCCTCCTATGCGTCTCTGTGTTCCTGGGAGTCGTGGGCCCCACACAGGCCTTACCCTTCATCCTCACCCATCTGAGTACCCGCAAGAGCAGCTGCAAATCCATCCCCGGCACTATGACCCTGTGCCACGGCGTGGGCTACACTGAGATGCGCCTGCCCAACCTGCTGGGACACGACACTATGAAGGAGGCTCTGCAGCAGGCGGGTTCCTGGGTGCCACTCCTTTCTAAACAGTGCCACGCAAACACCAAGAAGTTCCTCTGTTCTCTATTTGCCCCCGTGTGTTTGAGTGAACTAGATCAGGCCGTGTACCCCTGCAGGTCCCTCTGTGAGGCAGTGCGAGACGGCTGCACCCCCGTCATGTCTGCATTTGGCTTCCCCTGGCCTGATATGTTCAACTGCACCCAGTTTCCCCTGGGGAATGAGCTGTGTGTGCCCCCTGCTGGCAGTGAGGATAAACAACAAGAGCTTAAAGAGGAGGTGCCCTGCTCCGCCTGCCGTAACCGGGGTGACCCACACAAGGATTTCCTACAGAATTACTGCTCTTCTGATTTTGCTCTGAAGATGAACATCCCCTCAGTGTCCACCCTGGAAGGAGAAATCATGATGGGTTCCAGAATTTAAAAGCCAGGAACAGTGTATAAAAAACAAGGCCTGGAGTGGAGAATAAACTGAAAAAAAAAACTACCTCTGGGCGCCCAAATGGAAAACAAACTGGCCCCGCCCCCGGAAATTTCTTGAACCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGTTCCTCCTATGCGT

Sequences - 3ʹ (reverse) EST

Accession: JZ838195
dbEST ID: 79655897
Trimmed Sequence: GCAATGCATCTTGCGCACAGTTCTGGAAAATCTCTTGGTTTCCTTTTCACTCTTCTGCCACTTTCTGACCCATGAGATGACCAGTCTGTCGTCTGCCCGGTGGCCCAGAAGCAGCACGGTGGTGCCCGGCTCATGAATGTCCTGGCAGAGGCAGTTGTCTCCATCTGGCAGCCAGAGAAGCGTCTTCTTCAGCTCATCATCACTCCAGCCCTTGCTCTTATACACCGTCCTGCTCTTCACTTCTGGAACCACCATGATGTCTCCTTCCAGGGTGGACACTGAGCGGATGTTCATCTTCAGAGCAAAATCAGAAGAGCAGTAATTCTGTAGGAAATCCTTGTCTGGGTCACCCCGGTTACGGCAGGCGGAGCAGGGCACCTCCTCTTTAAGCTCTTGCTGTTTATCCTCACTGCCAGCAGGGGGCACACACAGCTCATTCCCCAGGGGAAACTGGGTGCAGTTGAACATATCANGCCAGGGGAAACCAAATGCAGACATGACGGGGGTGCAGCCGTCTCGCACTGCCTCACAGAGGGACCTGCAGGGGTACACGGCCTGAATCTAGTTCACTCAAACACACCAGGGGCCAATAAAAAACAGAAGGAACTTTCTTGTTGTCTGCGTGGCAATTGTTTAAAAAAGAAATTGGCACCAAGGAACCCCGCCCGGCTCCCAAACCCTCCCTTTCTAAATTTTCTTGGCCCCCGCCCAGGTTTGTGGCAGGGGGCCATTCTGATTGTTTACCCCAACACCCCGTTGT
Full Trace Sequence: GGGGAAACAGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAATGCATCTTGCGCACAGTTCTGGAAAATCTCTTGGTTTCCTTTTCACTCTTCTGCCACTTTCTGACCCATGAGATGACCAGTCTGTCGTCTGCCCGGTGGCCCAGAAGCAGCACGGTGGTGCCCGGCTCATGAATGTCCTGGCAGAGGCAGTTGTCTCCATCTGGCAGCCAGAGAAGCGTCTTCTTCAGCTCATCATCACTCCAGCCCTTGCTCTTATACACCGTCCTGCTCTTCACTTCTGGAACCACCATGATGTCTCCTTCCAGGGTGGACACTGAGCGGATGTTCATCTTCAGAGCAAAATCAGAAGAGCAGTAATTCTGTAGGAAATCCTTGTCTGGGTCACCCCGGTTACGGCAGGCGGAGCAGGGCACCTCCTCTTTAAGCTCTTGCTGTTTATCCTCACTGCCAGCAGGGGGCACACACAGCTCATTCCCCAGGGGAAACTGGGTGCAGTTGAACATATCANGCCAGGGGAAACCAAATGCAGACATGACGGGGGTGCAGCCGTCTCGCACTGCCTCACAGAGGGACCTGCAGGGGTACACGGCCTGAATCTAGTTCACTCAAACACACCAGGGGCCAATAAAAAACAGAAGGAACTTTCTTGTTGTCTGCGTGGCAATTGTTTAAAAAAGAAATTGGCACCAAGGAACCCCGCCCGGCTCCCAAACCCTCCCTTTCTAAATTTTCTTGGCCCCCGCCCAGGTTTGTGGCAGGGGGCCATTCTGATTGTTTACCCCAACACCCCGTTGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAATGCATCTTGCGCAC