ORFeome > sft2d2 ORF1 – XORFeome v1.0

sft2d2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sft2d2
Gene ID: 5821094
Gene Page ID: 5821051
ORF Xenbase ID: 17296125

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097797
Original XGC clone length: 483

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: D07

Sequences - 5ʹ (forward) EST

Accession: JZ838397
dbEST ID: 79656099
Trimmed Sequence: ATGGATAAGCTAAAGAAAGTCTTAAGTGGGCAGGATAACGAGGACAGGAACGGCTTTGAAGAGGTAATAGAAACAAGTTCACTAAGCTGGGGTACAAGAATCAAAGGCTTTATCGCTTGCTTTGTGATTGGTGTTGCTTGCTCCATTCTGGGTACTTGTCTCCTTTGGGTTCCAGGGAAAGGACTGGCTCTATTTGCAATTTTTTATACTATTGGAAACGTTGCATCTCTTGGAAGCACATTTTTTCTCATGGGCCCTTTGAAGCAATTAAAAAAGATGTTTGAGATGACTCGTTTAATCGCCACAATTGTTATGTTGCTTTGTCTGGTATTAACGTTATGTGCTGCTCTGTGGTGGAAGATCAAAGGACTTGCATTATTGTTCTGTATTTTGCAGTTTTTTGCAATGGCATGGTACAGCATTTCTTTCATCCCATTTGCAAGAGATGCTGTGAAGAAATGCTTTACAACATGTATTTCATT
Full Trace Sequence: GGGCTTTTTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGATAAGCTAAAGAAAGTCTTAAGTGGGCAGGATAACGAGGACAGGAACGGCTTTGAAGAGGTAATAGAAACAAGTTCACTAAGCTGGGGTACAAGAATCAAAGGCTTTATCGCTTGCTTTGTGATTGGTGTTGCTTGCTCCATTCTGGGTACTTGTCTCCTTTGGGTTCCAGGGAAAGGACTGGCTCTATTTGCAATTTTTTATACTATTGGAAACGTTGCATCTCTTGGAAGCACATTTTTTCTCATGGGCCCTTTGAAGCAATTAAAAAAGATGTTTGAGATGACTCGTTTAATCGCCACAATTGTTATGTTGCTTTGTCTGGTATTAACGTTATGTGCTGCTCTGTGGTGGAAGATCAAAGGACTTGCATTATTGTTCTGTATTTTGCAGTTTTTTGCAATGGCATGGTACAGCATTTCTTTCATCCCATTTGCAAGAGATGCTGTGAAGAAATGCTTTACAACATGTATTTCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACCTGGTCATAGCTGTTTCCTGGCAAATCTGGACCGTGTCTCCAAATCTCCGAAGGTAAAAAANNGTNNCACAAGGGCCTTGNCCCGGCGCGTCCTTCCTGCGCGGGGCCTGGGTGGACCGGCCCGCCGGCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATAAGCTAAAGAAAGTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838396
dbEST ID: 79656098
Trimmed Sequence: TGAAATACATGTTGTAAAGCATTTCTTCACAGCATCTCTTGCAAATGGGATGAAAGAAATGCTGTACCATGCCATTGCAAAAAACTGCAAAATACAGAACAATAATGCAAGTCCTTTGATCTTCCACCACAGAGCAACACATAACGTTAATACCAGACAAAGCAACATAACAATTGTGGCGATTAAACGAGTCATCTCAAACATCTTTTTTAATTGCTTCAAAGGGCCCATGAGAAAAAATGTGCTTCCAAGAGATGCAACGTTTCCAATAGTATAAAAAATTGCAAATAGAGCCAGTCCTTTCCCTGGAACCCAAAGGAGACAAGTACCCAGAATGGAGCAAGCAACACCAATCACAAAGCAAGCGATAAAGCCTTTGATTCTTGTACCCCAGCTTAGTGAACTTGTTTCTATTACCTCTTCAAAGCCGTTCCTGTCCTCGTTATCCTGCCCACTTAAGACTTTCTTTAGCTTATCCATGG
Full Trace Sequence: GGGAAACTGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGAAATACATGTTGTAAAGCATTTCTTCACAGCATCTCTTGCAAATGGGATGAAAGAAATGCTGTACCATGCCATTGCAAAAAACTGCAAAATACAGAACAATAATGCAAGTCCTTTGATCTTCCACCACAGAGCAACACATAACGTTAATACCAGACAAAGCAACATAACAATTGTGGCGATTAAACGAGTCATCTCAAACATCTTTTTTAATTGCTTCAAAGGGCCCATGAGAAAAAATGTGCTTCCAAGAGATGCAACGTTTCCAATAGTATAAAAAATTGCAAATAGAGCCAGTCCTTTCCCTGGAACCCAAAGGAGACAAGTACCCAGAATGGAGCAAGCAACACCAATCACAAAGCAAGCGATAAAGCCTTTGATTCTTGTACCCCAGCTTAGTGAACTTGTTTCTATTACCTCTTCAAAGCCGTTCCTGTCCTCGTTATCCTGCCCACTTAAGACTTTCTTTAGCTTATCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCAATGCTCATCAAATTGGTTGCAACGAACAAGTCCCTATCAGTCAAAATAAAAACCTTATTTGGGGCCCAAAATTAAAAAAAGACTGTCGGTTTACAAGACACTGGACGGGGGGGNNNTGAGTAAAGTGAAACAACCCAGATAAACCAAATGAGCATAAAAAAAAAAGGGGGAGGTGTAGCNNGCACGGATGGGGGGAAAATTAAGGAGGGAGAAATAACAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGAAATACATGTTGTAAAGCA