ORFeome > sft2d3 ORF1 – XORFeome v1.0

sft2d3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sft2d3
Gene ID: 5939563
Gene Page ID: 5939529
ORF Xenbase ID: 17296131

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123297
Original XGC clone length: 609

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: B06

Sequences - 5ʹ (forward) EST

Accession: JZ837511
dbEST ID: 79655213
Trimmed Sequence: ATGGCGGAGCTGGGTCGGCAGCTGCAGGAGTACGTGGCGCAAAGCAAATCGGGGAAAAGCGTCTCGGTTCCGGTAACCGCAGCCAATAACCCGGTTGGGGAACGAGCGGAGCCTGCGTGGAAGGCATGGATTGGCCATCACGTACCGACGCTTAGCGCTCTAGAGCCCGACCCCCTTCTGCCCGGTTTATCCAGCTCGCAGAGACTGATCGGAGCGGGACTGTGCGTGGCTGTAGCTGCTCTGTGCTTCGGTCTGTCTGGTATCTACGTGCCCATCCTCCTGCTCCGGGCTCGCAAGTTCGCGTTGCTCTGGTCCCTGGGCTCGGTGCTGGGCCTCGCCGCTGCCGCTCTCCTGAAAGGCCCCACCCGCCTCCTACGGGAACCGGAGCCGTGGAGTATGATGTACGTGGCTGCCCTGGGAGGGACTCTGTACGCCGCGCTGGGGATGCGCAGCACTGGCCTCACTGTGCTCGGGGCAGCCGCTCAGATCATCACCGCCGCCGGGCTCCTCTTGGGCTTGATTCCTGGCGGGGCCGTTGGCAGGCGCTACATCGGTAGCCTGTGCGGGAGCTTTCTGAGGAAAGGGGTAGCCAAGGCCCTGCCAGTGTT
Full Trace Sequence: GGCACACAATAATAGAATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGCTGGGTCGGCAGCTGCAGGAGTACGTGGCGCAAAGCAAATCGGGGAAAAGCGTCTCGGTTCCGGTAACCGCAGCCAATAACCCGGTTGGGGAACGAGCGGAGCCTGCGTGGAAGGCATGGATTGGCCATCACGTACCGACGCTTAGCGCTCTAGAGCCCGACCCCCTTCTGCCCGGTTTATCCAGCTCGCAGAGACTGATCGGAGCGGGACTGTGCGTGGCTGTAGCTGCTCTGTGCTTCGGTCTGTCTGGTATCTACGTGCCCATCCTCCTGCTCCGGGCTCGCAAGTTCGCGTTGCTCTGGTCCCTGGGCTCGGTGCTGGGCCTCGCCGCTGCCGCTCTCCTGAAAGGCCCCACCCGCCTCCTACGGGAACCGGAGCCGTGGAGTATGATGTACGTGGCTGCCCTGGGAGGGACTCTGTACGCCGCGCTGGGGATGCGCAGCACTGGCCTCACTGTGCTCGGGGCAGCCGCTCAGATCATCACCGCCGCCGGGCTCCTCTTGGGCTTGATTCCTGGCGGGGCCGTTGGCAGGCGCTACATCGGTAGCCTGTGCGGGAGCTTTCTGAGGAAAGGGGTAGCCAAGGCCCTGCCAGTGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAACTAAAATCCCCTATAATGGAGTCGGAATAAAAAAGAAAAAAAAAAAAATAACAAGAAAAATAAGAGACATGTTTAACAAAAAAAACCCCGCAAAAGTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGCTGGGTCGG

Sequences - 3ʹ (reverse) EST

Accession: JZ837510
dbEST ID: 79655212
Trimmed Sequence: CACTGGCAGGGCCTTGGCTACCCCTTTCCTCAGAAAGCTCCCGCACAGGCTACCGATGTAGCGCCTGCCAACGGCCCCGCCAGGAATCAAGCCCAAGAGGAGCCCGGCGGCGGTGATGATCTGAGCGGCTGCCCCGAGCACAGTGAGGCCAGTGCTGCGCATCCCCAGCGCGGCGTACAGAGTCCCTCCCAGGGCAGCCACGTACATCATACTCCACGGCTCCGGTTCCCGTAGGAGGCGGGTGGGGCCTTTCAGGAGAGCGGCAGCGGCGAGGCCCAGCACCGAGCCCAGGGACCAGAGCAACGCGAACTTGCGAGCCCGGAGCAGGAGGATGGGCACGTAGATACCAGACAGACCGAAGCACAGAGCAGCTACAGCCACGCACAGTCCCGCTCCGATCAGTCTCTGCGAGCTGGATAAACCGGGCAGAAGGGGGTCGGGCTCTAGAGCGCTAAGCGTCGGTACGTGATGGCCAATCCATGCCTTCCACGCAGGCTCCGCTCGTTCCCCAACCGGGTTATTGGCTGCGGTTACCGGAACCGAGACGCTTTTCCCCGATTTGCTTTGCGCCACGTACTCCTGCAGCTGCCGACCCACCTCCGCCATGG
Full Trace Sequence: AAAAAGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACACTGGCAGGGCCTTGGCTACCCCTTTCCTCAGAAAGCTCCCGCACAGGCTACCGATGTAGCGCCTGCCAACGGCCCCGCCAGGAATCAAGCCCAAGAGGAGCCCGGCGGCGGTGATGATCTGAGCGGCTGCCCCGAGCACAGTGAGGCCAGTGCTGCGCATCCCCAGCGCGGCGTACAGAGTCCCTCCCAGGGCAGCCACGTACATCATACTCCACGGCTCCGGTTCCCGTAGGAGGCGGGTGGGGCCTTTCAGGAGAGCGGCAGCGGCGAGGCCCAGCACCGAGCCCAGGGACCAGAGCAACGCGAACTTGCGAGCCCGGAGCAGGAGGATGGGCACGTAGATACCAGACAGACCGAAGCACAGAGCAGCTACAGCCACGCACAGTCCCGCTCCGATCAGTCTCTGCGAGCTGGATAAACCGGGCAGAAGGGGGTCGGGCTCTAGAGCGCTAAGCGTCGGTACGTGATGGCCAATCCATGCCTTCCACGCAGGCTCCGCTCGTTCCCCAACCGGGTTATTGGCTGCGGTTACCGGAACCGAGACGCTTTTCCCCGATTTGCTTTGCGCCACGTACTCCTGCAGCTGCCGACCCACCTCCGCCATGGTGGCAACTTTTTTGTACAAAGTTGGCGTAAAAAAAAAGCTTGCTCATCAATTTTGTTCCACCAAACAGGTCACTAACACGTCCAAATTAAAATCCGTTAAATTAAAAAGAACGAAAAAAAAAAAAAAAAAAAAATCATTTAAAAAAAAACGAACTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTGGCAGGGCCTTGGCTA