ORFeome > sftpb ORF1 – XORFeome v1.0

sftpb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sftpb
Gene ID: 866004
Gene Page ID: 490807
ORF Xenbase ID: 17296137

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC123315
Original XGC clone length: 1182

Human orthology & disease relationships

NCBI Entrez ID: 6439
Ensembl gene IDs: ENSG00000168878
Directly associated (OMIM) disease MIM numbers: 265120
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11082
Well Location: G10

Sequences - 5ʹ (forward) EST

Accession: JZ837283
dbEST ID: 79654985
Trimmed Sequence: ATGGAAGGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTATTGGAAAAACAAGTGAACCCTGACGCTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGGAGCATTTGTACAACGCACATGAAAAAGCAACGCAAGGTGATGGGTGAGGATTTGCCAATACCAAAGCCCATGTGCTGGATGTGCAAGTCGTTTTTCAGCCAATTAAAAAAAGTCATCCCAAACACAGTCCTTGCCCAAGCAGCCTCTCAACTGTGCCCGGAGCCTTCCGCGAAAGTAGCAGGTGTCTGCCGTTGTTTGGTGGAGAAATAGCAATAATTTACTTGGTATTTTTGTTGGAGAAGCGGGGGCCCCAGCGTCCGGTCAAAATTTCCTGTGGTATTGTTTCGGTGGGGGGAAGGAGTGGGGGGGACGGAGTTTTCAATGTTA
Full Trace Sequence: GGCGGGCCAAATAATGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAAGGGACACGCCTGATCTGGCTACTTACCCTGTGTGCAGCTGCAGTTCTGTCTGGGAAGGTCCCAGTAAAGGACGACTGCGCCCTGGGCCCGGAGTTCTGGTGTCAGGACCTGATGACAGCAGCTCAATGTGGAGCAGTGGATCACTGCAAGCAAACTGCCTGGTTAGGAATAGATGTGCTGTGCGTGCAGTGTAAGCAGATTGTGAACATCTTGCTGGACATGGTGAAGGCATCACCCATCCAGGACACCATAAAGAAATTCCTGCACAAGCAGTGTTCCCATCTCCCTGTGGTGCCTCTCATTGCTCAGTGCAACTTGCTGGTGGATCAGTATGAGTCTATGATGGTCACTGTATTGGAAAAACAAGTGAACCCTGACGCTCTGTGTTCCACCCTGAGACTTTGCCAATCTGACCAAGAAGAATTCTGGAATAATGAGCTGCAACCAGAAATGATCCTTGAAAAAATATTCCCTTTAATTCAGGAGCATTTGTACAACGCACATGAAAAAGCAACGCAAGGTGATGGGTGAGGATTTGCCAATACCAAAGCCCATGTGCTGGATGTGCAAGTCGTTTTTCAGCCAATTAAAAAAAGTCATCCCAAACACAGTCCTTGCCCAAGCAGCCTCTCAACTGTGCCCGGAGCCTTCCGCGAAAGTAGCAGGTGTCTGCCGTTGTTTGGTGGAGAAATAGCAATAATTTACTTGGTATTTTTGTTGGAGAAGCGGGGGCCCCAGCGTCCGGTCAAAATTTCCTGTGGTATTGTTTCGGTGGGGGGAAGGAGTGGGGGGGACGGAGTTTTCAATGTTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGGGACACGCCTGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837282
dbEST ID: 79654984
Trimmed Sequence: GTGCCACACATGGGTCAAACAGTGACTGACGGCCCCACACTCTTTAGCCGTTTCCAGGTTTTGACACCAATAAGAGGGTCCCACGGTACACCCAGAATGCTGTGCGGCTGCATTAGCAGGAACAGGACAAGCTCCCAGTGCCTGGCACGTCATCCTGTGGTCCCACTGCTTGTGCAGGAGGAGAGACAATTCCGTGTGATGGTTCTTAAGGAAAGTCTGGATCTCTTTCCATGCCATGCCCGGCTCTCCATGGGCTTTCAGAACTGCAGCCTCTACCTCTGCCTGGGTCATGTTCTGCTTTATGGTGGGTTTAATGGCAGAGGTAACAGCCAGGCATGTGTCACAGGCAAAATCAATATCCAGAACTGGTATCACTGGTAAATCTGCCTCGCAGTTCTCATCCGTGGCACACATGAACAGCAATTTGCACAGCAGCTGTGGCCCCAGCTTCTCCAGCACTATATCCAGTAAAATAACTGTGTATTTCTCCACCAAACACTGGCAGACACCTGCTACCTTCGCTGGAAGGATCCGGCACAGTTGAAAGGCTGCTTTGGCAATGACTGTCTTTTGGATGACTTTCTCTAATTGGCTGATAAGACAACTTTGCACATCCGCACAATGGCCTTTTGGGTGTGGCATATCCTCCCCATCACCCCTCCTTTGCTTTTTCATGTTGCGTTTTAAAGGGGGCGTCCTAAAATTGAGGGAAATAATTTTTTCAAG
Full Trace Sequence: GGGAAAAAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGCCACACATGGGTCAAACAGTGACTGACGGCCCCACACTCTTTAGCCGTTTCCAGGTTTTGACACCAATAAGAGGGTCCCACGGTACACCCAGAATGCTGTGCGGCTGCATTAGCAGGAACAGGACAAGCTCCCAGTGCCTGGCACGTCATCCTGTGGTCCCACTGCTTGTGCAGGAGGAGAGACAATTCCGTGTGATGGTTCTTAAGGAAAGTCTGGATCTCTTTCCATGCCATGCCCGGCTCTCCATGGGCTTTCAGAACTGCAGCCTCTACCTCTGCCTGGGTCATGTTCTGCTTTATGGTGGGTTTAATGGCAGAGGTAACAGCCAGGCATGTGTCACAGGCAAAATCAATATCCAGAACTGGTATCACTGGTAAATCTGCCTCGCAGTTCTCATCCGTGGCACACATGAACAGCAATTTGCACAGCAGCTGTGGCCCCAGCTTCTCCAGCACTATATCCAGTAAAATAACTGTGTATTTCTCCACCAAACACTGGCAGACACCTGCTACCTTCGCTGGAAGGATCCGGCACAGTTGAAAGGCTGCTTTGGCAATGACTGTCTTTTGGATGACTTTCTCTAATTGGCTGATAAGACAACTTTGCACATCCGCACAATGGCCTTTTGGGTGTGGCATATCCTCCCCATCACCCCTCCTTTGCTTTTTCATGTTGCGTTTTAAAGGGGGCGTCCTAAAATTGAGGGAAATAATTTTTTCAAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCCACACATGGGTCAA