ORFeome > sfxn1 ORF1 – XORFeome v1.0

sfxn1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sfxn1
Gene ID: 970150
Gene Page ID: 970144
ORF Xenbase ID: 17296143

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123216
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID: 94081
Ensembl gene IDs: ENSG00000164466
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 122700,188050,188055,202400,277450,607473

Library Location

Plate ID: GDExl11088
Well Location: F06

Sequences - 5ʹ (forward) EST

Accession: JZ838265
dbEST ID: 79655967
Trimmed Sequence: ATGTCAGGGGAATTAGCTTTAAATATTAACATCAAGGAGCCCCGCTGGGATCAGAGTACATTTGTTGGAAGAGCCAAGCATTTCTTCACTGTAACCGATCCGAGGAATATCCTTCTACCCAATGATCAGCTGGAACGGTCTCGGCAGATAGTTCATGACTACAGACAGGGTATTGTGGAGCCAGGACTGACTGAAGATGAACTGTGGAGAGCTAAGTATGTATATGATTCAGCATTTCATCCCGACACGGGTGAGAAGATGATCCTGATTGGGCGAATGTCAGCTCAGGTACCAATGAACATGACCATCACTGGCTGCATGATGACCTTTTACAGAACAGAAGGAGCTGTGGTCTTTTGGCAGTGGATTAATCAGTCTTTTAATGCCATCGTCAACTACACTAATAGGAGTGGAGATGCCCCCATCACTGTAAGCCAGCTGGGAACAGCTTATGTTTCTGCCACCACAGGTGCTGTTGCCACAGCTCTAGGACTTAATGCACTAACCAAGCGTGTCTCACCGCTTATAGGAAGATTTGTTCCCTTTGCTGCTGTTGCTGCCGCTAACTGTATCAATATTCCATTAATGCGGCAAAGGGAGTTGAAATATGGTATTCCAGTCACAGATGAAAACGGAAACCGAATTGGAGAAATCGCAAACCCTGCTTAGCAGGCCATTACCCAAGTCGTTGTTTTCTCTAACCTAATTGGCGCCTCCGTGGCGGGAAGGATCCCCNCNTTTTTTTTTTTTNCNTTTTTTNAAAAAAAAAANTCTTTTTCTTTNTNTTTTTTCCCTTTTTTTTTCACCCCCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCAGGGGAATTAGCTTTAAATATTAACATCAAGGAGCCCCGCTGGGATCAGAGTACATTTGTTGGAAGAGCCAAGCATTTCTTCACTGTAACCGATCCGAGGAATATCCTTCTACCCAATGATCAGCTGGAACGGTCTCGGCAGATAGTTCATGACTACAGACAGGGTATTGTGGAGCCAGGACTGACTGAAGATGAACTGTGGAGAGCTAAGTATGTATATGATTCAGCATTTCATCCCGACACGGGTGAGAAGATGATCCTGATTGGGCGAATGTCAGCTCAGGTACCAATGAACATGACCATCACTGGCTGCATGATGACCTTTTACAGAACAGAAGGAGCTGTGGTCTTTTGGCAGTGGATTAATCAGTCTTTTAATGCCATCGTCAACTACACTAATAGGAGTGGAGATGCCCCCATCACTGTAAGCCAGCTGGGAACAGCTTATGTTTCTGCCACCACAGGTGCTGTTGCCACAGCTCTAGGACTTAATGCACTAACCAAGCGTGTCTCACCGCTTATAGGAAGATTTGTTCCCTTTGCTGCTGTTGCTGCCGCTAACTGTATCAATATTCCATTAATGCGGCAAAGGGAGTTGAAATATGGTATTCCAGTCACAGATGAAAACGGAAACCGAATTGGAGAAATCGCAAACCCTGCTTAGCAGGCCATTACCCAAGTCGTTGTTTTCTCTAACCTAATTGGCGCCTCCGTGGCGGGAAGGATCCCCNCNTTTTTTTTTTTTNCNTTTTTTNAAAAAAAAAANTCTTTTTCTTTNTNTTTTTTCCCTTTTTTTTTCACCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCAGGGGAATTAGCTTTAAAT

Sequences - 3ʹ (reverse) EST

Accession: JZ838264
dbEST ID: 79655966
Trimmed Sequence: CAATCCTTTGTTGAAGTAAACGCGCGCCAACCCTGGACTGTTTTCTTTAATTTTTGCTTGAAGTTCAGGCTCCAGACGGGTCACAGACATTGAGCTATTCTGGGGAAACAGTGCGCAACAGAGAGGCGTGGCAAATACCAAACAGAATCCTACTAATCCTACTTGGATAGGGGCGCTCATCCATGGGAATCGTTTTAGAAAGGCTTTCTTTTCCAAAGTGTTCATTATGAAAGGAGGGATGGCCATGCCAGGAGCAGCCATTAAGATACGAGAAACAACGACTTGGGTAATGGCCTGCTTAGCAGCGTTTGCAGATTCTCCAATTCGGTTTCCGTTTTCATCTGTGACTGGAATACCATATTTCAACTCCCTTTGCCGCATTAATGGAATATTGATACAGTTAGCGGCAGCAACAGCAGCAAAGGGAACAAATCTTCCTATAAGCGGTGAGACACGCTTGGTTAGTGCATTAAGTCCTAGAGCTGTGGCAACAGCACCTGTGGTGGCAGAAACATAAGCTGTTCCCAGCTGGCTTACAGTGATGGGGGCATCTCCACTCCTATTAGTGTAGTTGACGATGGCATTAAAAGACTGATTAATCCACTGCCAAAAGACCACACCCTGAATTTGTTCTGTAAAAGGTCATCATGCAACCCAGTGATGGTTATGTTTATTTGGTACCCGAAACCTGAACATCCCCCCCAATCCAGGAAAAATCCTTCCTCCCCCCCCTTGGTCCGGGAAAAAAAAAATGCCGA
Full Trace Sequence: GGGCGCGATGCGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACAATCCTTTGTTGAAGTAAACGCGCGCCAACCCTGGACTGTTTTCTTTAATTTTTGCTTGAAGTTCAGGCTCCAGACGGGTCACAGACATTGAGCTATTCTGGGGAAACAGTGCGCAACAGAGAGGCGTGGCAAATACCAAACAGAATCCTACTAATCCTACTTGGATAGGGGCGCTCATCCATGGGAATCGTTTTAGAAAGGCTTTCTTTTCCAAAGTGTTCATTATGAAAGGAGGGATGGCCATGCCAGGAGCAGCCATTAAGATACGAGAAACAACGACTTGGGTAATGGCCTGCTTAGCAGCGTTTGCAGATTCTCCAATTCGGTTTCCGTTTTCATCTGTGACTGGAATACCATATTTCAACTCCCTTTGCCGCATTAATGGAATATTGATACAGTTAGCGGCAGCAACAGCAGCAAAGGGAACAAATCTTCCTATAAGCGGTGAGACACGCTTGGTTAGTGCATTAAGTCCTAGAGCTGTGGCAACAGCACCTGTGGTGGCAGAAACATAAGCTGTTCCCAGCTGGCTTACAGTGATGGGGGCATCTCCACTCCTATTAGTGTAGTTGACGATGGCATTAAAAGACTGATTAATCCACTGCCAAAAGACCACACCCTGAATTTGTTCTGTAAAAGGTCATCATGCAACCCAGTGATGGTTATGTTTATTTGGTACCCGAAACCTGAACATCCCCCCCAATCCAGGAAAAATCCTTCCTCCCCCCCCTTGGTCCGGGAAAAAAAAAATGCCGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACAATCCTTTGTTGAAGTAAACGC