ORFeome > sfxn3 ORF1 – XORFeome v1.0

sfxn3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sfxn3
Gene ID: 5846633
Gene Page ID: 5846620
ORF Xenbase ID: 17296155

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC044027
Original XGC clone length: 969

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11016
Well Location: H10

Sequences - 5ʹ (forward) EST

Accession: JZ824348
dbEST ID: 79642050
Trimmed Sequence: ATGTCTCAGGAACTGCCCTTCAACATCGACATCAAAGAACCACAATGGGATCAGAGCACCTTTGAGGGAAGAGCCAAGCACTTCTTCACAGTGACCGATCCACGGAATGTCCTGCTTGGGCCTAAAGTCCTAGAGGAAGCAAAGAACATTGTACAGAATTACAGAAAGGGGATCCCCACACCAGGTTTAACTGAAGACCAGCTATGGCGAGCAAAATACATCTACGATTCTGCTTTCCATCCGGATACAGGAGAGAAGATGATCTTGATAGGAAGGATGTCTGCACAGGTGCCCATGAATATGACCATCACTGGCTGCATGCTGACATTTTTCAGAACAACTCCAGCTGTTATATTTTGGCAGTGGGTGAATCAGTCCTTCAATGCTATTGTGAATTATACAAATAGAAGTGGTGATGCACCCATAACAACAAGCCAGCTGGGGACAGCTTACGTCAGTGCAACTACAGGTGCTGTTGTGACTGCTCTGGGACTCAAATCACTCACTAAGCATCTACCTTCTCTGGGTTGGGAGATTTGTTCCATTTTGCCGCAGTAGCAGCAGCCAACTGCATCAACATCCCTCTGATGAGGCAGAGAGAATTAANATATGGCATCCCCATCACAGATGAAAATGGCAACAGGCTCGGAGAATNNCTACAAGCTGCTCAGCAGGCATAGCAAAAAGTGGTGTGGTTCTCGGATTGGGAATGGCTGGCCCCGCCATGGCCATTCCCCCCGTGAATATGAATGCTTTGGAAAAAAAAAGGGTTCCTAAAACGGAACCCCACGGAGAAGGTCCCCTCCACCAGGGGGGGGGGGGGGGTTTTGGTTGGGT
Full Trace Sequence: ATTGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCTCAGGAACTGCCCTTCAACATCGACATCAAAGAACCACAATGGGATCAGAGCACCTTTGAGGGAAGAGCCAAGCACTTCTTCACAGTGACCGATCCACGGAATGTCCTGCTTGGGCCTAAAGTCCTAGAGGAAGCAAAGAACATTGTACAGAATTACAGAAAGGGGATCCCCACACCAGGTTTAACTGAAGACCAGCTATGGCGAGCAAAATACATCTACGATTCTGCTTTCCATCCGGATACAGGAGAGAAGATGATCTTGATAGGAAGGATGTCTGCACAGGTGCCCATGAATATGACCATCACTGGCTGCATGCTGACATTTTTCAGAACAACTCCAGCTGTTATATTTTGGCAGTGGGTGAATCAGTCCTTCAATGCTATTGTGAATTATACAAATAGAAGTGGTGATGCACCCATAACAACAAGCCAGCTGGGGACAGCTTACGTCAGTGCAACTACAGGTGCTGTTGTGACTGCTCTGGGACTCAAATCACTCACTAAGCATCTACCTTCTCTGGGTTGGGAGATTTGTTCCATTTTGCCGCAGTAGCAGCAGCCAACTGCATCAACATCCCTCTGATGAGGCAGAGAGAATTAANATATGGCATCCCCATCACAGATGAAAATGGCAACAGGCTCGGAGAATNNCTACAAGCTGCTCAGCAGGCATAGCAAAAAGTGGTGTGGTTCTCGGATTGGGAATGGCTGGCCCCGCCATGGCCATTCCCCCCGTGAATATGAATGCTTTGGAAAAAAAAAGGGTTCCTAAAACGGAACCCCACGGAGAAGGTCCCCTCCACCAGGGGGGGGGGGGGGGTTTTGGTTGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCAGGAACTGCCCTT

Sequences - 3ʹ (reverse) EST

Accession: JZ829707
dbEST ID: 79647409
Trimmed Sequence: AAGTCCTTTGTTAAAATACACAATCTTGGTGTCTGGACTCTTCTTCAGAACCTCAGCTTGAACTTCCGGCTCCAGCCTGGACAAACTCATTGAGCTTTTCTGAGGGAAAAGTGCACAGCACAGAGGGGTTGCAAAGACCAAGCAAAAGCCAACCAGCCCCACTTGTAGAGGAGCATTCATCCATGGGTACCGCTTTAGGAACGCTCTCTTCTCCAAAGCATTCATTATCACTGGGGGAATTGCCATTGCTGGGGCAGCCATTCCAATCCGGGACACCACCACTTGTGCTATGGCCTGCTGAGCAGCTTTGGTAGATTCTCCGAGCCTGTTGCCATTTTCATCTGTGATGGGGATGCCATATTTTAATTCTCTCTGCCTCATCAGAGGGATGTTGATGCAGTTGGCTGCTGCTACTGCGGCAAATGGAACAAATCTCCCAACCAGAGAAGGTAGATGCTTAGTGAGTGATTTGAGTCCCAGAGCAGTCACAACAGCACCTGTAGTTGCACTGACGTAAGCTGTCCCCAGCTGGCTTGTTGTTATGGGTGCATCACCACTTCTATTTGTATAATTCACAATAGCATTGAAGGACTGATTCACCCACTGCCAAAATATAACAGCTGGGAGTGTTCTGAAAAATGTCAGCATGCCACCCGTGATGGTCATATTCATGGGCACCTGGTCAGACNTCCCTTCTAATCAGATCATCTTTCCCTCCTGGTATCCGAAAGGAAAAAAAAAAAACAGAAAAATTATTTTTGCTCCCCCCAAAAT
Full Trace Sequence: CACGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTNGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAAGTCCTTTGTTAAAATACACAATCTTGGTGTCTGGACTCTTCTTCAGAACCTCAGCTTGAACTTCCGGCTCCAGCCTGGACAAACTCATTGAGCTTTTCTGAGGGAAAAGTGCACAGCACAGAGGGGTTGCAAAGACCAAGCAAAAGCCAACCAGCCCCACTTGTAGAGGAGCATTCATCCATGGGTACCGCTTTAGGAACGCTCTCTTCTCCAAAGCATTCATTATCACTGGGGGAATTGCCATTGCTGGGGCAGCCATTCCAATCCGGGACACCACCACTTGTGCTATGGCCTGCTGAGCAGCTTTGGTAGATTCTCCGAGCCTGTTGCCATTTTCATCTGTGATGGGGATGCCATATTTTAATTCTCTCTGCCTCATCAGAGGGATGTTGATGCAGTTGGCTGCTGCTACTGCGGCAAATGGAACAAATCTCCCAACCAGAGAAGGTAGATGCTTAGTGAGTGATTTGAGTCCCAGAGCAGTCACAACAGCACCTGTAGTTGCACTGACGTAAGCTGTCCCCAGCTGGCTTGTTGTTATGGGTGCATCACCACTTCTATTTGTATAATTCACAATAGCATTGAAGGACTGATTCACCCACTGCCAAAATATAACAGCTGGGAGTGTTCTGAAAAATGTCAGCATGCCACCCGTGATGGTCATATTCATGGGCACCTGGTCAGACNTCCCTTCTAATCAGATCATCTTTCCCTCCTGGTATCCGAAAGGAAAAAAAAAAAACAGAAAAATTATTTTTGCTCCCCCCAAAAT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGTCCTTTGTTAAAATACACAAT