ORFeome > sgcb ORF1 – XORFeome v1.0

sgcb ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sgcb
Gene ID: 6252765
Gene Page ID: 943306
ORF Xenbase ID: 17296167

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC154981
Original XGC clone length: 930

Human orthology & disease relationships

NCBI Entrez ID: 6443
Ensembl gene IDs: ENSG00000163069,LRG_204
Directly associated (OMIM) disease MIM numbers: 604286
Indirectly associated (Lage, et al.) disease MIM numbers: 253700,300376,302045,310200,601287,604286,606685,608099

Library Location

Plate ID: GDExl11092
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: JZ838992
dbEST ID: 79656694
Trimmed Sequence: ATGGCAACTGCTGAGGAGCAGAGTTCCAATGGCCCAGTGAAGAAGTCTATGCGTGAGAAGGCAGTTGAGCGAAGGACCATCAATAAAGAAGCACAACAGCAACTTCAAAGCAGGTTATATTCCTATTGATGAAGATCGTCTGCATAAAACTGGCTTGAGAGGCCGGAAAGGGAACTTAGCCATTTGTGTGATCGTCCTGCTGTTTATCTTGGCTGTCATCAACTTAATAATTACTTTAGTTATATGGGTTGTGATCCGAATTGGTCCAAATGGCTGCGATAGTATGGAGTTCCATGACAGCGGCTTGCTTCGATTTAAACAAGTATCAGACATGGGAGTAATACATCCGTTATACAAAAGTACCATTGGAGGACGACGTAATGAAGATCTCGTGATCACTGGTAACAACCAGCCTGTTATTTTTCAACAGGGCTCAACAAAACTCAGCGTGGATAAAGACAAGACTTCTATCACCAGCGACATTGGCATGGAGTTTATTGATCCTCGCACTCAGAATACATTGTTCATCACAGACTATGAGAAACATGAATTTCATCTGCCAAAAGGGGTGAGGACTTTGAATGTACAGAGGGCTTCAACTGATAGGATTACTAGCAATGCTACCAGTGATCTCAGCATAAAATCAGATGGTCGAGTCATTGTCCGTGGTAAATGAAGGGGGTGTCGGTCGGGGGGAAAAACAGTGGAATTTTCCTTTGGGTGGGGAAGAGGGGGGGGTGGAAGCTAAAAAAAACCAAAGTCCTAAATTGGCAACAGGGAGGGGGGGGGGGTTTCCGGGGCAGGCCGGCCCCTCCTCTACAAGGGGAAATTTTTTCTTTCCACAAA
Full Trace Sequence: GTCCCCAAATAATAGGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCAACTGCTGAGGAGCAGAGTTCCAATGGCCCAGTGAAGAAGTCTATGCGTGAGAAGGCAGTTGAGCGAAGGACCATCAATAAAGAAGCACAACAGCAACTTCAAAGCAGGTTATATTCCTATTGATGAAGATCGTCTGCATAAAACTGGCTTGAGAGGCCGGAAAGGGAACTTAGCCATTTGTGTGATCGTCCTGCTGTTTATCTTGGCTGTCATCAACTTAATAATTACTTTAGTTATATGGGTTGTGATCCGAATTGGTCCAAATGGCTGCGATAGTATGGAGTTCCATGACAGCGGCTTGCTTCGATTTAAACAAGTATCAGACATGGGAGTAATACATCCGTTATACAAAAGTACCATTGGAGGACGACGTAATGAAGATCTCGTGATCACTGGTAACAACCAGCCTGTTATTTTTCAACAGGGCTCAACAAAACTCAGCGTGGATAAAGACAAGACTTCTATCACCAGCGACATTGGCATGGAGTTTATTGATCCTCGCACTCAGAATACATTGTTCATCACAGACTATGAGAAACATGAATTTCATCTGCCAAAAGGGGTGAGGACTTTGAATGTACAGAGGGCTTCAACTGATAGGATTACTAGCAATGCTACCAGTGATCTCAGCATAAAATCAGATGGTCGAGTCATTGTCCGTGGTAAATGAAGGGGGTGTCGGTCGGGGGGAAAAACAGTGGAATTTTCCTTTGGGTGGGGAAGAGGGGGGGGTGGAAGCTAAAAAAAACCAAAGTCCTAAATTGGCAACAGGGAGGGGGGGGGGGTTTCCGGGGCAGGCCGGCCCCTCCTCTACAAGGGGAAATTTTTTCTTTCCACAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAGCTGCTGAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ838991
dbEST ID: 79656693
Trimmed Sequence: GCACGGGTTGCTTGATGTTTGGCATCCCATGTTGCGACTTTCCACCTTCACCCTAAAGAGGGTTCCATCAGCACATGAGCAGAGCTTGTAGCGCATCCATCCATCGTCGTACAGCAACTCCCCTGTAGAAGAGCTGGGTAGTCGGGAAGTACTCACCATCACTGTGCCATTTAGGACTATGCTGTTCTCAGCTTTGAGCTCCATATTCCCACCCATGCGAAACTCAATAGTCTTTCCCATGATGAACACCCCTTCATTACCACGGACAATGACTCGACCATCTGATTTTATGTTGAGATCACTGGTAGCATTGCTAGTAATCCTCTCAGTTGAAGCCCTCTGTACATTCAAAGTTTTCACCCCTTTTGGCAGATGAAATTCATGTTTCTCATAGTCTGTGCTGAACAATGTATTCTGAGTGCGAGGATCAATAAACTCCATGCCAATGTCGCTGGTGATAGAAGTCTTGTCTTTATCCACGCTGAGTTTTGTTGAGCGCTGTTGAAGAATAACAGGCTGGTTGTTACCAGTGAACACGAGATCTTCATTACTTCCTCCTCCATGGTACTTTTGTATAACGGAAGTAATACTTCCATGTCTGAAGACTTGTTTAAATCGAAGCAAACCCGCTGGCCTGGAAGTTCCGGACCTATCGCAACCCCTTTTGAACCCAATTGGGGAACCCAACCCCAAATAACCTAAAATTAAATTATTAAAATTTTAAAAAACACCCCCAAAAAAAAAACGGGCAGGGAAAGAAATTAC
Full Trace Sequence: GGGCAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCACGGGTTGCTTGATGTTTGGCATCCCATGTTGCGACTTTCCACCTTCACCCTAAAGAGGGTTCCATCAGCACATGAGCAGAGCTTGTAGCGCATCCATCCATCGTCGTACAGCAACTCCCCTGTAGAAGAGCTGGGTAGTCGGGAAGTACTCACCATCACTGTGCCATTTAGGACTATGCTGTTCTCAGCTTTGAGCTCCATATTCCCACCCATGCGAAACTCAATAGTCTTTCCCATGATGAACACCCCTTCATTACCACGGACAATGACTCGACCATCTGATTTTATGTTGAGATCACTGGTAGCATTGCTAGTAATCCTCTCAGTTGAAGCCCTCTGTACATTCAAAGTTTTCACCCCTTTTGGCAGATGAAATTCATGTTTCTCATAGTCTGTGCTGAACAATGTATTCTGAGTGCGAGGATCAATAAACTCCATGCCAATGTCGCTGGTGATAGAAGTCTTGTCTTTATCCACGCTGAGTTTTGTTGAGCGCTGTTGAAGAATAACAGGCTGGTTGTTACCAGTGAACACGAGATCTTCATTACTTCCTCCTCCATGGTACTTTTGTATAACGGAAGTAATACTTCCATGTCTGAAGACTTGTTTAAATCGAAGCAAACCCGCTGGCCTGGAAGTTCCGGACCTATCGCAACCCCTTTTGAACCCAATTGGGGAACCCAACCCCAAATAACCTAAAATTAAATTATTAAAATTTTAAAAAACACCCCCAAAAAAAAAACGGGCAGGGAAAGAAATTAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCACGGGTTGCTTGATGTT