ORFeome > sgol1 ORF1 – XORFeome v1.0

sgol1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sgol1
Gene ID: 940797
Gene Page ID: 940794
ORF Xenbase ID: 17296203

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099060
Original XGC clone length: 1992

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: H06

Sequences - 5ʹ (forward) EST

Accession: JZ838435
dbEST ID: 79656137
Trimmed Sequence: ATGGTAAAGGAAAGATGCCCAAGCCGCAAACGTCGATGCAAAGTCAGCATTAATTATGCAGAGCCAAAACTCAGTGGGAAACTCAGAAGAGGAGATCCTTTCACCGATTCCGAATTTTTGCAATCTCCTATTTTTAAGAATGAATCGAAACGCAACTCCTTGAACAGACAGTCTCTTTCTAGATACAATGAAGTATTTGTTGGCTGCCGCAGATT
Full Trace Sequence: GCTCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTAAAGGAAAGATGCCCAAGCCGCAAACGTCGATGCAAAGTCAGCATTAATTATGCAGAGCCAAAACTCAGTGGGAAACTCAGAAGAGGAGATCCTTTCACCGATTCCGAATTTTTGCAATCTCCTATTTTTAAGAATGAATCGAAACGCAACTCCTTGAACAGACAGTCTCTTTCTAGATACAATGAAGTATTTGTTGGCTGCCGCAGATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCGTGAAGAAAAATCTATGATGTTACACTTCATGCCACTGGAGATGAGCGGGGTCAGATATGCCTGGACGTCCCTGCTGAACAAGGGAGCGGGGTGGTTTCAGCTGGTAAACGGAGGAAGGGTCCCGCGTGGGGGAAAACGGCCGGAAGGGTATGAAAGCGTATGGCAAGTAGGGACCGAGACGCTGGTACTGGTCCCGAACCTTGAACGAAAGCCCCGGGGGGCCGGGGCGGAGGGGGGTCCAAGGCTGGTTATAAAGGTCTTTGGGGGGGACGGGCCGCCTCGGGCGTTAAAACGGCGATGGGTGATGAGCGGGGGGGTTGGGGTGTAGTGTTCAGGACCACCGGGGGCTTGCCCAGGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAAAGGAAAGATGCCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838434
dbEST ID: 79656136
Trimmed Sequence: TCTGCGGCAGCCAACAAATACTTCATTGTATCTAGAAAGAGACTGTCTGTTCAAGGAGTTGCGTTTCGATTCATTCTTAAAAATAGGAGATTGCAAAAATTCGGAATCGGTGAAAGGATCTCCTCTTCTGAGTTTCCCACTGAGTTTTGGCTCTGCATAATTAATGCTGACTTTGCATCGACGTTTGCGGCTTGGGCATCTTTCCTTTACCATGG
Full Trace Sequence: GGGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATCTGCGGCAGCCAACAAATACTTCATTGTATCTAGAAAGAGACTGTCTGTTCAAGGAGTTGCGTTTCGATTCATTCTTAAAAATAGGAGATTGCAAAAATTCGGAATCGGTGAAAGGATCTCCTCTTCTGAGTTTCCCACTGAGTTTTGGCTCTGCATAATTAATGCTGACTTTGCATCGACGTTTGCGGCTTGGGCATCTTTCCTTTACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGGGACAGAAAAAAAAAAGCTATCGATAATCCTGGATTAAGGAGATGCCCCGCGACAGATATGACGCGAGGTTGCTGCGGACAACTGGGGCTTTGTGATGAAACGGTGTGGAACGGAGGAAGGGACGAAGCCCGTGGACATAAGCCTGGTCGGGTCGTAAAAGGGAGTGCAAGTAGCGGAAAGGACTCCCCCACTGGGGCAAAAACCGTGACGAGCGCGACGGTGGGAGGGGCGCGGGGGGGGTTTTTTGGTTGGTATGAANGTTGTTTATGGGNNAAGAGNAGCGGGGGGGGAGAAAAANGGGGAGAGGAGGAGNGGGGGGGAGGGGGGAGAGGGGGGAGGGNNGGGNNTGANAGGGAGAGGGGGGGAGGGGGNGAAAGGGGGGNNGGGGGGGGGNNNANGAAGGGGAANGNGGGGN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTGCGGCAGCCAACAA