ORFeome > sgpp2 ORF1 – XORFeome v1.0

sgpp2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sgpp2
Gene ID: 6256143
Gene Page ID: 967103
ORF Xenbase ID: 17296215

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC129599
Original XGC clone length: 1203

Human orthology & disease relationships

NCBI Entrez ID: 130367
Ensembl gene IDs: ENSG00000163082
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 230800,230900,231000,231005,245200,257200,607616,608013

Library Location

Plate ID: GDExl11086
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ837859
dbEST ID: 79655561
Trimmed Sequence: ATGGCCCAGCTGCTGAAAAGTCTGCAGGACCCACAGCTGGTGGCCCAATTCCAGAGGTACTGTGGGCTGACCCTGCAGCCAAAGGGTGAGGCTAATGGGATTTCTCCAGGGAATTATCATTTAGAGACCAATCAAAGAGGAAGGGGCAAGAGCACAGGGGGCAACGGAATTCCCCAGCAAAATGGCAACACCATCCACAGCAATGGATCATATGCAAATGGAGCACCCAAACAGGGCATTGCCAAGAAATACCAGGTGCAGAACTACTTTCTGTATTACCTCTTCAGATTTGCCGCTGCTCTGGGACAAGAAGTGTTTTACATCACTTTCTTACCTTTCACTTACTGGAATCTTGATCCATTCATAGGGCATCGCCTGGTTGTTGTCTGGGCCATTGTCATGTATTTAGGCCAAGCTTCTAAGGACCTTCTAAAATGGCCACGTCCTTCATCTCCCCCTGTGGTAAAGCTGGAAACCAGAGTAGATGCTGAATATGGAATGCCCTCTACACATGCTATTGCTGCTACTGCAATCTCATTCACCTTCCTTTTGGCAACAATGGGGCGATACCAGTACCCATTTTGGCTTGGATTTTTGGCTGCACTCTTCTTATCCACTCTTGTGTCCCTCAACAGGCTGTATACGGGGATGCATACTGTGGTGGATGTCATTTTGTGAGCTTTAATTGCCCTTGTTATTTTTTGCCATTACCTTACCCCCAAGGGAACAAGAATGGAAAAAAGTGAATTATTGGCCCACCCTCTCCTCTCCCCCTTTTTTAAAATTAATTTTTGGGGCTTTTCCTCTCAAGTTTTACAACCTCC
Full Trace Sequence: TCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGCTGCTGAAAAGTCTGCAGGACCCACAGCTGGTGGCCCAATTCCAGAGGTACTGTGGGCTGACCCTGCAGCCAAAGGGTGAGGCTAATGGGATTTCTCCAGGGAATTATCATTTAGAGACCAATCAAAGAGGAAGGGGCAAGAGCACAGGGGGCAACGGAATTCCCCAGCAAAATGGCAACACCATCCACAGCAATGGATCATATGCAAATGGAGCACCCAAACAGGGCATTGCCAAGAAATACCAGGTGCAGAACTACTTTCTGTATTACCTCTTCAGATTTGCCGCTGCTCTGGGACAAGAAGTGTTTTACATCACTTTCTTACCTTTCACTTACTGGAATCTTGATCCATTCATAGGGCATCGCCTGGTTGTTGTCTGGGCCATTGTCATGTATTTAGGCCAAGCTTCTAAGGACCTTCTAAAATGGCCACGTCCTTCATCTCCCCCTGTGGTAAAGCTGGAAACCAGAGTAGATGCTGAATATGGAATGCCCTCTACACATGCTATTGCTGCTACTGCAATCTCATTCACCTTCCTTTTGGCAACAATGGGGCGATACCAGTACCCATTTTGGCTTGGATTTTTGGCTGCACTCTTCTTATCCACTCTTGTGTCCCTCAACAGGCTGTATACGGGGATGCATACTGTGGTGGATGTCATTTTGTGAGCTTTAATTGCCCTTGTTATTTTTTGCCATTACCTTACCCCCAAGGGAACAAGAATGGAAAAAAGTGAATTATTGGCCCACCCTCTCCTCTCCCCCTTTTTTAAAATTAATTTTTGGGGCTTTTCCTCTCAAGTTTTACAACCTCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGCTGCTGAA

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGCGGGCAAACAGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATATTCCAAAAAGGCCCCAAACCGAAGAACCCCAGCCGGAACCACCAAACCCAATGAAATGGAAGGCACAAATTTGGAAGGAACCTCCATTTCCCGTCCTTGCCTTACCAAAAGGGCCCCAATACCAACATTGGGGCCTTTACCAAGAACCCGGAATGAAAATGGTTTTGCCAGAAATCCTGGTAAGAACCAAAAAATGAACCCCAAAAAAAACCCCCCCGGTTGGAATAACACCTGAAGCCAACCAATGGGGGGAATGGGCCGTGGAAAGTGGGCTGAAAGGATGGAATTTCATTCAAGTTTTCCGAATGAAAACCCCCCACCTGGGCCCACTGCCACCCCCATTATAATTCTAATGGCCGCCCCGGTGGGGCCATAATGAATTCTTTTAAGGTAATTTTTACTTTAAAAAAAACCCCCAAAGAATGGTAATACCGGAAAAGAAAGGTGGCCCATAATCACTTTTTTCATCCTGGTCCCGAACGGGTAAGTTAATGCCCAAAAAAACAGGGCAATTAAAACTCCCCAAAATAAATCCAACAAAAGAAGCCTCCCGTTTTACCGCCTGCCGAAGGACACAAGAGTGGATAAGAAAAATTCCACCCAAAATCCCAGCCCAAATGGGGACCGGGTTTCCCCCATTGTTCCCAAAGGAAGGTGAATGAGATTGCAATACCAACAAAAACTGTGGTAAAGGACTTCCGAATCCNCATCTACTCTGGTTCCCGCCTTACCACAAGGGGGAAAAGAGGAACTAGCCATTTTAAANGTCCTTAAGAACGTTGACCAGAGACGGAAAAAGGGCCAAAAGAACACAAGCCAAGCCCTAGGAGAGGGAAGAAATTCCGGTAAGNGAAAANGGAGAAAGGTGGGTAGAACCCTCCGGTGCCAGANGCACCCCCGAAGCGAAGAGGGAAAAAAAAAAAGAAAATGCGGCCCCNGNATTCCTTAGGAAAGCCGGGGATGGGGGCCGCCGGTGTGGGATGGAACCATTGCGGGNGGAGGGAGGTGGCGGGTGGTGGGGGGGAGATGGCGNTGGGGCGGAGGGGGGCGCGACGCCCCNNCCGCCTTGGAGAAGGAGGGNCCANNATAGANGANNAGTTCGTGCGGGAANAAAAAAAAGNGCAGAAAAAAGNACGGGGGGACCGCAAAGTGTAAGAGAAGGNGAAGGGNGGGGCAGGGGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATATTCCTAGAAAGTCACAAAGCTG