ORFeome > sh3bgr ORF1 – XORFeome v1.0

sh3bgr ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: sh3bgr
Gene ID: 946025
Gene Page ID: 946019
ORF Xenbase ID: 17296239

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078489
Original XGC clone length: 408

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11004
Well Location: A09

Sequences - 5ʹ (forward) EST

Accession: JZ839693
dbEST ID: 79657395
Trimmed Sequence: ATGGTTATTAAGGTCTTTGTGGCTACCGTGGCAGGATCCACTGCGATAAAAAAGAAGCAACAAGAAGTAGTGGGGTTTTTGGAGGCCAACCGAATTGACTTTGAACAAAAGGATATTGCGTGTAATGATGACAATCGCCAATGGATGAGGGAAAACGTCCCCGGGGAGAAGAAACCGGAGAATGGGATTCCTCTTCCTCCCCAGATTTTCAACGAAGAACAGTATTGTGGGGACTTTGAATCGTTCTTTGATGCTAAAGAAGGAAATGAAATATTTGTGTTCCTGGGATTAACTCCACCTGCGAGTAAAAAGAAATCGGAAGTACCAACTGATGTGCAAAACGAGATGGTTCCCGCAGAAGAGAGCTCTGTTCAAGAAGAAGTAGAAGAAGAAGTAGAGCAAGAATT
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTTATTAAGGTCTTTGTGGCTACCGTGGCAGGATCCACTGCGATAAAAAAGAAGCAACAAGAAGTAGTGGGGTTTTTGGAGGCCAACCGAATTGACTTTGAACAAAAGGATATTGCGTGTAATGATGACAATCGCCAATGGATGAGGGAAAACGTCCCCGGGGAGAAGAAACCGGAGAATGGGATTCCTCTTCCTCCCCAGATTTTCAACGAAGAACAGTATTGTGGGGACTTTGAATCGTTCTTTGATGCTAAAGAAGGAAATGAAATATTTGTGTTCCTGGGATTAACTCCACCTGCGAGTAAAAAGAAATCGGAAGTACCAACTGATGTGCAAAACGAGATGGTTCCCGCAGAAGAGAGCTCTGTTCAAGAAGAAGTAGAAGAAGAAGTAGAGCAAGAATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCAAAAAACACTAGAACATGTCTCAAATCTCTTAAAGTTACAGCCCCCGGGGCNNTTGGCCCCCGTTTCCCTTCCCCCGGGGCCGGGGGGTCTTCTCCGCGTAAAAAAAAAAAAACAAAAGAAAAAAAAACCCGGGGGGCGGGTTTTTGGGGGAAAAGAAGGGGCCGGGGGGGGGGGCCAAACCTTCCCCCACCCCCGGGGGTGGGGGGGGGGGGGGGGGTTTAGATGTGTTTGTAGTTTTTTATTTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTTATTAAGGTCTTTGTGGCT

Sequences - 3ʹ (reverse) EST

Accession: JZ839692
dbEST ID: 79657394
Trimmed Sequence: TTCTTGCTCTACTTCTTCTTCTACTTCTTCTTGAACAGAGCTCTCTTCTGCGGGAACCATCTCGTTTTGCACATCAGTTGGTACTTCCGATTTCTTTTTACTCGCAGGTGGAGTTAATCCCAGGAACACAAATATTTCATTTCCTTCTTTAGCATCAAAGAACGATTCAAAGTCCCCACAATACTGTTCTTCGTTGAAAATCTGGGGAGGAAGAGGAATCCCATTCTCCGGTTTCTTCTCCCCGGGGACGTTTTCCCTCATCCATTGGCGATTGTCATCATTACACGCAATATCCTTTTGTTCAAAGTCAATTCGGTTGGCCTCCAAAAACCCCACTACTTCTTGTTGCTTCTTTTTTATCGCAGTGGATCCTGCCACGGTAGCCACAAAGACCTTAATAACCATGG
Full Trace Sequence: AACAGTCTATTGACCATGTAATACGACTCACTATACGGGGATATCAGCTTGGATGGCAAAAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTTGCTCTACTTCTTCTTCTACTTCTTCTTGAACAGAGCTCTCTTCTGCGGGAACCATCTCGTTTTGCACATCAGTTGGTACTTCCGATTTCTTTTTACTCGCAGGTGGAGTTAATCCCAGGAACACAAATATTTCATTTCCTTCTTTAGCATCAAAGAACGATTCAAAGTCCCCACAATACTGTTCTTCGTTGAAAATCTGGGGAGGAAGAGGAATCCCATTCTCCGGTTTCTTCTCCCCGGGGACGTTTTCCCTCATCCATTGGCGATTGTCATCATTACACGCAATATCCTTTTGTTCAAAGTCAATTCGGTTGGCCTCCAAAAACCCCACTACTTCTTGTTGCTTCTTTTTTATCGCAGTGGATCCTGCCACGGTAGCCACAAAGACCTTAATAACCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGGCCCAAGAATAAAACTGGCCGTCATTTTACACGCCGCGTGGGGAGGGGCGGGGGGCAAAAAAGACCAAAAGCTCATGCCCCAAAGGGGGGGGGTGGATTATACGGTGGTTGTGGGAGAAAGGACACCACCATGGGACAAAACCCCCTGGGGCGCGAAATCAAAGATGTGGAAACGTCGGCCGCCCACGCCAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTTGCTCTACTTCTTCTTCTAC