ORFeome > sh3gl2 ORF1 – XORFeome v1.0

sh3gl2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sh3gl2
Gene ID: 1012096
Gene Page ID: 1012089
ORF Xenbase ID: 17296299

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC097775
Original XGC clone length: 1062

Human orthology & disease relationships

NCBI Entrez ID: 6456
Ensembl gene IDs: ENSG00000107295
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 102200,103580,166350,173100,174800,209950,219050,262400,262650,266600,274500,600802,601665,607276,609135

Library Location

Plate ID: GDExl11089
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ838377
dbEST ID: 79656079
Trimmed Sequence: ATGTCGGTAGCAGGGTTCAAGAAGCAGTTTCACAAAGCCACTCAGAAAGTGAGTGAGAAAGTTGGAGGAGCCGAGGGGACCAAGCTAGATGAAGACTTCAAAGAAATGGAGAGGAAAGTGGATACAACCAGTAAGGCCGTCATGGAGATAATGACAAAAACAACAGAGTATCTCCAGCCTAACCCAGCTTCCAGGGCAAAACTCACCATGCTGAACACAATGTCAAAGATTCGAGGGCAGGAGAAAGGCCCGGGTTACCCTCAAGCTGAAGCTTTATTGGCTGAAGCAATGTTCAAATTTGGAAAAGAAATTGGCGATGAGTCAAATTTTGGCTTAGCGCTGCTTGATGTAGGAGAAGCAATGAGGGAGCTCTCAGATATCAAAGACTCCTTGGATATTGATGTGAAGCAGAACTTCATAGACCCACTGCAGAACTTACATGACAAAGATCTCAGAGAGATTCAGCATCACCTGAAAAAGTTGGAAGGCAGGCGACTGGACTTTGATTACAAAAAGAAACGGCAAGGCAAAATTACAGATGATGAAATCCGCCAGGCATTAGAAAAGTTTGATGAGTCCAAAGAAATTGCAGAATCAAGCATGTTCAACCTGTTGGAGATGGATATTGAGCAGGTAAACCAGCTCTCGGCACTTGCACAAGCACAACTGGAGT
Full Trace Sequence: GGGGGGCCCACATAATAGATTTTANTTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGTAGCAGGGTTCAAGAAGCAGTTTCACAAAGCCACTCAGAAAGTGAGTGAGAAAGTTGGAGGAGCCGAGGGGACCAAGCTAGATGAAGACTTCAAAGAAATGGAGAGGAAAGTGGATACAACCAGTAAGGCCGTCATGGAGATAATGACAAAAACAACAGAGTATCTCCAGCCTAACCCAGCTTCCAGGGCAAAACTCACCATGCTGAACACAATGTCAAAGATTCGAGGGCAGGAGAAAGGCCCGGGTTACCCTCAAGCTGAAGCTTTATTGGCTGAAGCAATGTTCAAATTTGGAAAAGAAATTGGCGATGAGTCAAATTTTGGCTTAGCGCTGCTTGATGTAGGAGAAGCAATGAGGGAGCTCTCAGATATCAAAGACTCCTTGGATATTGATGTGAAGCAGAACTTCATAGACCCACTGCAGAACTTACATGACAAAGATCTCAGAGAGATTCAGCATCACCTGAAAAAGTTGGAAGGCAGGCGACTGGACTTTGATTACAAAAAGAAACGGCAAGGCAAAATTACAGATGATGAAATCCGCCAGGCATTAGAAAAGTTTGATGAGTCCAAAGAAATTGCAGAATCAAGCATGTTCAACCTGTTGGAGATGGATATTGAGCAGGTAAACCAGCTCTCGGCACTTGCACAAGCACAACTGGAGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGTAGCAGGGTTC

Sequences - 3ʹ (reverse) EST

Accession: JZ838376
dbEST ID: 79656078
Trimmed Sequence: GTGGGGCAGGGGTACTAGGATGTCAACGTAATTGATTGGAAAGAAGCCTGACTGGCCATGAAGCATCCCTTCATACCAGTTTTCATCAATCTGATTGGTGAGAGTAATGATGTCGCCCTCCTTGAAGCCAAGTTCACCTTCATTTTCTGGATCAAAGTCGTACAATGATCGACAGCATGGCTGGTCCATGGGAGTCCCTGATGGTTTGGGGGTCCCTGCAAGAGCAATACCCCCATTATGTTGGCTGTTTTCACTTGGGGGTGCAAGCTCCAAGCTCATGCGTGGCTTAGGCAGATATTCTCTTCTGGGCTGATCTGAAGCATCTCTTACTCTCTGCTCCAGTTTCACAGCAACATGCTGTAAGATTTGCGTTGCTTGCCTGTGATACTCCAATTGTGCTTGTGCAAATGCCGACAGCTGGTTTAGCTGCTCAGTATCACATTTCCACAGGTTGAACATACTTGATTCTGCAATTTCTTTGTAACTCAACAAACTTTATCAGTGCCCTGGGGGGAGGGGGTCATCTGGAATTTTGCCTTACCGGTTGCAGTTTGTAATCCAAATGCAGTCGGCGGCCTTCCACCTTTTTTCAGATGATGCGGAGGGGTGAGAAGAACATTGTAAGGTGAGTTGCTGGAGGGGGGCGAAGGAAAGTTTA
Full Trace Sequence: GGGAAAAAGGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGGGGCAGGGGTACTAGGATGTCAACGTAATTGATTGGAAAGAAGCCTGACTGGCCATGAAGCATCCCTTCATACCAGTTTTCATCAATCTGATTGGTGAGAGTAATGATGTCGCCCTCCTTGAAGCCAAGTTCACCTTCATTTTCTGGATCAAAGTCGTACAATGATCGACAGCATGGCTGGTCCATGGGAGTCCCTGATGGTTTGGGGGTCCCTGCAAGAGCAATACCCCCATTATGTTGGCTGTTTTCACTTGGGGGTGCAAGCTCCAAGCTCATGCGTGGCTTAGGCAGATATTCTCTTCTGGGCTGATCTGAAGCATCTCTTACTCTCTGCTCCAGTTTCACAGCAACATGCTGTAAGATTTGCGTTGCTTGCCTGTGATACTCCAATTGTGCTTGTGCAAATGCCGACAGCTGGTTTAGCTGCTCAGTATCACATTTCCACAGGTTGAACATACTTGATTCTGCAATTTCTTTGTAACTCAACAAACTTTATCAGTGCCCTGGGGGGAGGGGGTCATCTGGAATTTTGCCTTACCGGTTGCAGTTTGTAATCCAAATGCAGTCGGCGGCCTTCCACCTTTTTTCAGATGATGCGGAGGGGTGAGAAGAACATTGTAAGGTGAGTTGCTGGAGGGGGGCGAAGGAAAGTTTA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGGGCAGGGGTACTAGGA