ORFeome > shfm1 ORF1 – XORFeome v1.0

shfm1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: shfm1
Gene ID: 1016356
Gene Page ID: 1016349
ORF Xenbase ID: 17296383

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC078531
Original XGC clone length: 216

Human orthology & disease relationships

NCBI Entrez ID: 7979
Ensembl gene IDs: ENSG00000127922
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 114480,145980,239200

Library Location

Plate ID: GDExl11004
Well Location: E09

Sequences - 5ʹ (forward) EST

Accession: JZ839632
dbEST ID: 79657334
Trimmed Sequence: ATGTCGTCTGATAAGAAGCCACCGGTTGATTTGGGTCTTTTGGAAGAGGACGATGAGTTCGAAGAGTTTCCCACCGAAGACTGGACGGGTTTCGATGAAGATGAAGATACACATGTCTGGGAAGATAACTGGGATGATGACAATGTAGAAGATGATTTTTCAAATCAGTTAAGGGCTGAATTAGAGAAACACGGATACAAGATGGAGACATCATT
Full Trace Sequence: CTGCGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGTCTGATAAGAAGCCACCGGTTGATTTGGGTCTTTTGGAAGAGGACGATGAGTTCGAAGAGTTTCCCACCGAAGACTGGACGGGTTTCGATGAAGATGAAGATACACATGTCTGGGAAGATAACTGGGATGATGACAATGTAGAAGATGATTTTTCAAATCAGTTAAGGGCTGAATTAGAGAAACACGGATACAAGATGGAGACATCATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCGTCCGGGTGATATCCCCTATAGTGAGTCGTATTACATGGTCATAGCTGTTTCCTGGCAGCTCTGGCCCAAGGCACAAAAGCAAAGATGTAACAAGAGTCCGGAACAGCAGGGAAGAAAAGAAAGCAAAAAGTTCAGTGGGACGCCAGGGCGCCTGGTGGCGCAAGCTGTGTGAACGTGGTGAGCGCTCCAACCGGTGCACATGAGGCCTGTACGGATTGGAAACTGGAGGAACGGCACGCACGCGGGGGGGCCAACTGGGCCGGGATCGTGACCGAACGCCGCTGGGGGAAAGGGGGGCGTGGGGGGGTTTCCGGGGCTTGGGTTAGACAAGTTTTTTTGGGGAAAAAGCCAGGGCGCGGGGGATCCCGGCCCACAAGGGCGGTTTTCCCCGGGGGGGTGGGGTTTTGGGGGTTGTGGTTTTTTTAAGGGCAGTGTTTACCCCCCCCGGGGCCCCGCCCCCCCCTACAACAAAAAGCAAACCCCTTTGGGAGGGGTGGGGGGCGGGGGGTGGGGGGGGGGAGAGAAGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTCTGATAAGAAGCC

Sequences - 3ʹ (reverse) EST

Accession: JZ839631
dbEST ID: 79657333
Trimmed Sequence: TGATGTCTCCATCTTGTATCCGTGTTTCTCTAATTCAGCCCTTAACTGATTTGAAAAATCATCTTCTACATTGTCATCATCCCAGTTATCTTCCCAGACATGTGTATCTTCATCTTCATCGAAACCCGTCCAGTCTTCGGTGGGAAACTCTTCGAACTCATCGTCCTCTTCCAAAAGACCCAAATCAACCGGTGGCTTCTTATCAGACGACATGG
Full Trace Sequence: GGCGTAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATGATGTCTCCATCTTGTATCCGTGTTTCTCTAATTCAGCCCTTAACTGATTTGAAAAATCATCTTCTACATTGTCATCATCCCAGTTATCTTCCCAGACATGTGTATCTTCATCTTCATCGAAACCCGTCCAGTCTTCGGTGGGAAACTCTTCGAACTCATCGTCCTCTTCCAAAAGACCCAAATCAACCGGTGGCTTCTTATCAGACGACATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGGGCCCGACCTTAATACTGTACAAAAACAATAAAAAAACTGTTAAAGCAAGACTCCGGAACAGCAAGCGCTGCCAAAAAGCGACAAGCTCACTGGGACCCTTGGTCGCCGGGTGTAACAGCTGTGGGAAGGGGAAAACGCACGAAACCAGAGGAATACGCCCGGACGGATTTGAGCGGTAATGCAGTAGCCAAGGAGGTCAGGCAACTGGTCCCCAAGCCTGACCGAACGCACGGGGGTAACGGCGCAGTGCGGGAAAGAGGGGTTGTTATACTGGTTTATGGGGGGAAAGTTTTTGCTCGGGCCACCAGCACCAGCCGCGTCACCCCGGGGGGGAGGTTTTGGTGTTGATGGGATAGCTAATATGTTTACCAACAGGGGCA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATGATGTCTCCATCTTGTATCCGT