ORFeome > shoc2 ORF1 – XORFeome v1.0

shoc2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: shoc2
Gene ID: 493506
Gene Page ID: 493501
ORF Xenbase ID: 17296413

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042263
Original XGC clone length: 1734

Human orthology & disease relationships

NCBI Entrez ID: 8036
Ensembl gene IDs: ENSG00000108061
Directly associated (OMIM) disease MIM numbers: 607721
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,115150,125853,218040,607785,609942

Library Location

Plate ID: GDExl11015
Well Location: D12

Sequences - 5ʹ (forward) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: TAAGTAATATATTGTTTTTTTATTCTTTTCTATGTATATCTAGCTCCCGTCTCTCTGCGCACACCTATGTATATACATGCTAGTTCTTTTTTTATATCCGCGCCCTCTCTTGTGTCACACAATTATTTGTGCACCCCTGTGAGCAATAGGCAAACATGCTTTATATCCTTCTTTACAGCTCAGCTCCAGGCGCGGGAGTCAAGACAAAACAATGAGTCAGTGTCTCATGGTCTCACGGACTGCTGCCACCCCGCAATCTCCTCAGGATGCTAACTGTGACCCACGGTGTAGTGGCACAACACCCTCGTCTTCGTCATGCGTCGGGGTCACGGACCTCGGTACTGTGCCACTGTATTATAATATCCCATCACCAGGACACACAGATAGGCTGTCTAGCTGTCCGGGTCTCCAACTTGTCTACCTCCGATTCTTAGGATTGTCGCTCAACTGTCTGATCAAGAAGTGAACGATGCTCGCACTCTCACACCTGTTATGCTGATGTCTCGCATTTCATATATGGGTCGCGAGAGCGAGAGGTGACTCGCAAGTCCCTCTCGCGCCTGTGGAAAAGTGAGTGTGATGTAGAGCAGAGTGGAATCTGGGTCGTCCTAGCTCGTGAATCGGGGTGGGTATGTTCGGAGACAAGCACTTACTCGCTAATTTATTCTCTCGCAATAGGAACAATTATACTGCTGCCCGGGGGACGAGAATCACTGTGTAGCTCTTGTGCCTTGCATGGTGCGCTCTTATGTCCAGATGTACACGCAGCACCTTTCGCTTCCATCGCTACCACTCGGTTCTTGTTTTATTTCGTATGGTTGGGGGGGATGGGTGGGAGGAGGTTGGGTGCAGAACATCATCCTGGCGATGAGAGCAATCCCACCCCAACACCGCTCCCCGATCTTGGCGAATATATTTGGATCCCCTTTCTTCCTTTTTTCACATACTCCTTTGATTCCCTTTTCCCCTGGGGGTAACATGACGTGGAGGGAGGAGAGAGGAGGAATAGAAACCAACTCTTGGGAGCCGGAGTCGGACGTTAAGCATAACTGCTTTATCCTTCCGCCCTTTTTCTACCATTTGCCCCACAGTGTGTGCCTGGTTATGTTTGTTATTTCTGTGTTTAGGGGTGGGATTCTGTGAAAACCCGGGGAACACAGTGAGGAGGCTGGCCACCGCGCCGCCCCGCGCTCCCTCCCGCGCCTCCCAACCACCAACCCCTTCCTAACCTCCGCACCCCCCCCCGGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGTAGCGCAGGA

Sequences - 3ʹ (reverse) EST

Accession: JZ829645
dbEST ID: 79647347
Trimmed Sequence: GACCATGGCACGATAAGGACCTTGCATTTTCAAGAACTGAATGATGAATGACGGGCCCCCAGCGACAATCTGGGGGGGAAGGTGGCTGAGCGGACAGTTCTCAATACTCATGATGGACAGTTTGCTGCACAGAGCGAGCTCAAAGGGGAGGCTGTGTAAATTGGGGTTATCGTTCAGATACAGCTCCTCCAAATTCTCCAGTGTACCTATTTCTTCTGGAAGATGGGTGAGGAGGTTTTCCCCAAGGCCAAGGTGCGTGAGATTGGTGAGGTGGCCGATTCCTCTGGGTAACGTGGTTAACTGGTTATTAGTGAGGACCAATTTCTGCAGATCCTTGAGATAGGCAATTTCATTAGGCAGGGACTCCAGCTTGTTCTCTTCAAGGTCCAGTTCTCTCAGCTTGCGCAGGTTCCCAATACCGTGTGGCAGCTTCTTCAGGAGGTTGTTGGAGAGAATGAGAACCTCTATAGAGACAAGGCCAGATACATCCTCGGGAATCTTTGTTAATTGATTAGTAGCCAGATTTAATTCCACCATACTTGTCCAGGTTCCAAAATCCAGGGGGGAGAGAAGTCAGCTGATTGTCCTTCATGTTCAGCTTACTCAATACTTTCGCTCTTGAAAAGATTCCAAATGGGATCTTGTTTATGCGATTGTGCTCCATGGTGGAGGAAGTAAATAAAGGAAGAACTGGGGAGGGCCCCCCCCACTGGGTAAAGACTGGAAAACAGTTTTCCGGCCCCAGGGGTTAAAACTTTTTTCCCTT
Full Trace Sequence: CCGCGAAACAGCTATGACCATGTAATACGACTCACTATCAGTGAAAATAAAATCGTTATGTTGGGGCCCGAGCTTATTACTGGACGTCGTTTTGCAACGTCGTGACTGGGAATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGACCATGGCACGATAAGGACCTTGCATTTTCAAGAACTGAATGATGAATGACGGGCCCCCAGCGACAATCTGGGGGGGAAGGTGGCTGAGCGGACAGTTCTCAATACTCATGATGGACAGTTTGCTGCACAGAGCGAGCTCAAAGGGGAGGCTGTGTAAATTGGGGTTATCGTTCAGATACAGCTCCTCCAAATTCTCCAGTGTACCTATTTCTTCTGGAAGATGGGTGAGGAGGTTTTCCCCAAGGCCAAGGTGCGTGAGATTGGTGAGGTGGCCGATTCCTCTGGGTAACGTGGTTAACTGGTTATTAGTGAGGACCAATTTCTGCAGATCCTTGAGATAGGCAATTTCATTAGGCAGGGACTCCAGCTTGTTCTCTTCAAGGTCCAGTTCTCTCAGCTTGCGCAGGTTCCCAATACCGTGTGGCAGCTTCTTCAGGAGGTTGTTGGAGAGAATGAGAACCTCTATAGAGACAAGGCCAGATACATCCTCGGGAATCTTTGTTAATTGATTAGTAGCCAGATTTAATTCCACCATACTTGTCCAGGTTCCAAAATCCAGGGGGGAGAGAAGTCAGCTGATTGTCCTTCATGTTCAGCTTACTCAATACTTTCGCTCTTGAAAAGATTCCAAATGGGATCTTGTTTATGCGATTGTGCTCCATGGTGGAGGAAGTAAATAAAGGAAGAACTGGGGAGGGCCCCCCCCACTGGGTAAAGACTGGAAAACAGTTTTCCGGCCCCAGGGGTTAAAACTTTTTTCCCTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACCATGGCACGATAAGGA