ORFeome > shpk ORF1 – XORFeome v1.0

shpk ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: shpk
Gene ID: 991312
Gene Page ID: 991308
ORF Xenbase ID: 17296419

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123343
Original XGC clone length: 1401

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11083
Well Location: A10

Sequences - 5ʹ (forward) EST

Accession: JZ837368
dbEST ID: 79655070
Trimmed Sequence: ATGGAGAGTAAGGCGTCTCGCTTGGTGCTGGGGCTTGACGTGGGCACGAGTTCTGTGAAAGCCGCGCTGTTAGACGCTGCCTCCGGGAATGTAGTTCATAGTCAGAGCCGGGAAACCCGGGCTGCGGTGCAGAGTGAGTGCGGCCCACAGGGGAAAGAACAAGATGTCGTCCTGATAATGAGAACCCTAAATGATTGTGTGTCTTCTCTACCCAAGGAAAGGCTTAAAGAAGTTGTGCGCATTGGAGTATCTGGACAAATGCATGGAGTCATGTTCTGGAAAACGAACCAAGGTTGTCATTGGATAAACAGTGGTAATCTGCGAGTGTTTGAACCAAGAGACACCAGTTACCTTATTACCTGGGAAGATGGCCGATGCAGTATGGACTTTTTGGCTTCATTACCTCAACCACAATCCCATCTCTCTTTGGCAACGGGCTTTGGCTGTGCAACTATATTCTGGTATTTGAAGAACAGGCCAGATTTTCTTGATTCATATGATGCTGCTGGCACTATTCAAGACTATGTGGTTGCTATGTTGTGTGGCCTGCAGAGACCTCAGATGTCGGTTCACAGTGCAGCCAGTTGGGGCTATTTTCATGCCAGATCTAAAACATTGAATACGGACCTATACATGGAGCTGGAATCCCAGTGTTTCTACTCCCTGACCTTTTTAATGCTGGGTGTGGGGGAGGGAAAACATCCTAACCAATGTGTTTGGAGTCGGCCGGGGACGGAAAGGTGGGGAATGGCCTTGGGGAAAACTTCCGGGGTTTATTTTATTTTTTGTCTGGACAAAAAAGAATAAAAAAAAAG
Full Trace Sequence: GGGGGCCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGAGTAAGGCGTCTCGCTTGGTGCTGGGGCTTGACGTGGGCACGAGTTCTGTGAAAGCCGCGCTGTTAGACGCTGCCTCCGGGAATGTAGTTCATAGTCAGAGCCGGGAAACCCGGGCTGCGGTGCAGAGTGAGTGCGGCCCACAGGGGAAAGAACAAGATGTCGTCCTGATAATGAGAACCCTAAATGATTGTGTGTCTTCTCTACCCAAGGAAAGGCTTAAAGAAGTTGTGCGCATTGGAGTATCTGGACAAATGCATGGAGTCATGTTCTGGAAAACGAACCAAGGTTGTCATTGGATAAACAGTGGTAATCTGCGAGTGTTTGAACCAAGAGACACCAGTTACCTTATTACCTGGGAAGATGGCCGATGCAGTATGGACTTTTTGGCTTCATTACCTCAACCACAATCCCATCTCTCTTTGGCAACGGGCTTTGGCTGTGCAACTATATTCTGGTATTTGAAGAACAGGCCAGATTTTCTTGATTCATATGATGCTGCTGGCACTATTCAAGACTATGTGGTTGCTATGTTGTGTGGCCTGCAGAGACCTCAGATGTCGGTTCACAGTGCAGCCAGTTGGGGCTATTTTCATGCCAGATCTAAAACATTGAATACGGACCTATACATGGAGCTGGAATCCCAGTGTTTCTACTCCCTGACCTTTTTAATGCTGGGTGTGGGGGAGGGAAAACATCCTAACCAATGTGTTTGGAGTCGGCCGGGGACGGAAAGGTGGGGAATGGCCTTGGGGAAAACTTCCGGGGTTTATTTTATTTTTTGTCTGGACAAAAAAGAATAAAAAAAAAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAGTAAGGCGTCTCGCTTG

Sequences - 3ʹ (reverse) EST

Accession: JZ837367
dbEST ID: 79655069
Trimmed Sequence: CCATTGCTTTGCCATTACCATAGCAGCACCTAAAGCTGAATCTGTATCTTTTCCATATAGAATAGGAAATGGGAAGATTTTTTCCACTTCCTGCTTTAACACTTCATTCCGGGACAAAGCACTGCCACTTCCAATGAGCCTCTTAACGCCAGATTCCTGAAGTCGACTGGAGGGCAACATGGAATGCAGGTTCTGAACGATGCCCCGGCAGAGTGCCCTAGTCACATGGCCCAATGAAAGCTCTGCTGCCATGATGTTTGTTACGGACGCCAGTATATCAGGAGTATGTCTCTCACCAAACAATGTAGGGTTAATATTAAGATGGGTTTCATGCTGAGACAGACCGGCTGTAATCACCCGGGTATATAAGGTGGAAGCAGGAATATCAAGTCCGAATTCAGCAATCCAGTCTGATAACATTGTGATGAACGATGCAAGAACATTTCCTCCATTCAGAGAAGCAGCAACAGCCAAGTAACGGTCATTGAAGTATGGAAAATAGGCGACAGATTCTCCAGGGCTGGGGCGGTCTTCAGGCTGGAAACCCTCTGCCATGGAGAAAGTCAGCTGAGCAGAGGTGCTTATGTTGAGGACTGCATCTGTACTTTCTGTGGCAGAATAATATACAGAACACTGAAAGTCTCCCAGAACAACTCCACCCTCCTTCCCTTGGTGAATGCCCACCCACTTCGTAAAAAGCTTTTCTTAACCCGCACCCCCCATTTAACAAACCTTCCGGAGAATAAAAAACCATGGGGAAAAC
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACCATTGCTTTGCCATTACCATAGCAGCACCTAAAGCTGAATCTGTATCTTTTCCATATAGAATAGGAAATGGGAAGATTTTTTCCACTTCCTGCTTTAACACTTCATTCCGGGACAAAGCACTGCCACTTCCAATGAGCCTCTTAACGCCAGATTCCTGAAGTCGACTGGAGGGCAACATGGAATGCAGGTTCTGAACGATGCCCCGGCAGAGTGCCCTAGTCACATGGCCCAATGAAAGCTCTGCTGCCATGATGTTTGTTACGGACGCCAGTATATCAGGAGTATGTCTCTCACCAAACAATGTAGGGTTAATATTAAGATGGGTTTCATGCTGAGACAGACCGGCTGTAATCACCCGGGTATATAAGGTGGAAGCAGGAATATCAAGTCCGAATTCAGCAATCCAGTCTGATAACATTGTGATGAACGATGCAAGAACATTTCCTCCATTCAGAGAAGCAGCAACAGCCAAGTAACGGTCATTGAAGTATGGAAAATAGGCGACAGATTCTCCAGGGCTGGGGCGGTCTTCAGGCTGGAAACCCTCTGCCATGGAGAAAGTCAGCTGAGCAGAGGTGCTTATGTTGAGGACTGCATCTGTACTTTCTGTGGCAGAATAATATACAGAACACTGAAAGTCTCCCAGAACAACTCCACCCTCCTTCCCTTGGTGAATGCCCACCCACTTCGTAAAAAGCTTTTCTTAACCCGCACCCCCCATTTAACAAACCTTCCGGAGAATAAAAAACCATGGGGAAAAC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACCATTGCTTTGCCATTACC