ORFeome > sirt3.2 ORF1 – XORFeome v1.0

sirt3.2 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: sirt3.2
Gene ID: 6255591
Gene Page ID: 5721493
ORF Xenbase ID: 17296467

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC097921
Original XGC clone length: 1053

Human orthology & disease relationships

NCBI Entrez ID: 23410
Ensembl gene IDs: ENSG00000142082
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 202370,214100,609016

Library Location

Plate ID: GDExl11089
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ838417
dbEST ID: 79656119
Trimmed Sequence: ATGAAGGCATTAGCGACTACTTCTGCCTTCCAAACTACGGTGATAGAAGACCAGAATACACAGGAGGCTGTGGACTCAAAACATCCACTGGACTATCTGTCAAGGAAAAGAGAGAATGATCGGCTTTCTGGTGTTATAAAGCAAAGGAAGAGGCAACTGCCAAAGAGCACACTGGTGAAAAATATTTCCGCTATAAAGCCAAATAAATGTCCAATGGGGTGTAAGGATCTAGCAGATATATTAGATCTTATTGCAAGAAACTGCTGCAGGAACATTATCGTTATGGCTGGAGCCGGGATAAGCACAGCTAGTGGGATACCGGATTTTAGATCACCTGGCTCAGGAATCTATGACAACCTGCAAAAGTATGACATTCCATACCCGGAAGCCATTTTTGACATCAACTACTTTGTATGTAACCCAAAGCCTTTCTTCCACCTGGCCAAGGAACTGTACCCCGGGAAGTACAAACCCAACCTCGTCCACTACTTTGTAAGGCTGCTGCACGACAAAGGTCTGTTGCTGAGATGTTACACCCAGAATATTGATGGCCTAGAAAGATTGGCTGGCATTCCTGTTGAAAGAATCGTCGAAGTGCATGGCACCTTCTCATCAGCATCTTGCAGCTTGTGCTACACCCCATTCCCCACTAATGAAGCCAAGGAATTGATCCTTGAATGGAATCCATCCCCGCTGTACGTTCTGTTTCTGGGCCTGTGAAA
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGCATTAGCGACTACTTCTGCCTTCCAAACTACGGTGATAGAAGACCAGAATACACAGGAGGCTGTGGACTCAAAACATCCACTGGACTATCTGTCAAGGAAAAGAGAGAATGATCGGCTTTCTGGTGTTATAAAGCAAAGGAAGAGGCAACTGCCAAAGAGCACACTGGTGAAAAATATTTCCGCTATAAAGCCAAATAAATGTCCAATGGGGTGTAAGGATCTAGCAGATATATTAGATCTTATTGCAAGAAACTGCTGCAGGAACATTATCGTTATGGCTGGAGCCGGGATAAGCACAGCTAGTGGGATACCGGATTTTAGATCACCTGGCTCAGGAATCTATGACAACCTGCAAAAGTATGACATTCCATACCCGGAAGCCATTTTTGACATCAACTACTTTGTATGTAACCCAAAGCCTTTCTTCCACCTGGCCAAGGAACTGTACCCCGGGAAGTACAAACCCAACCTCGTCCACTACTTTGTAAGGCTGCTGCACGACAAAGGTCTGTTGCTGAGATGTTACACCCAGAATATTGATGGCCTAGAAAGATTGGCTGGCATTCCTGTTGAAAGAATCGTCGAAGTGCATGGCACCTTCTCATCAGCATCTTGCAGCTTGTGCTACACCCCATTCCCCACTAATGAAGCCAAGGAATTGATCCTTGAATGGAATCCATCCCCGCTGTACGTTCTGTTTCTGGGCCTGTGAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGCATTAGCGACTAC

Sequences - 3ʹ (reverse) EST

Accession: #N/A
dbEST ID: #N/A
Trimmed Sequence: #N/A
Full Trace Sequence: GGGAAAAGTCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTGTCCAGTTGCCTGCTCCGTGGGGGATTTCATTAGTTTCTCTAGTTCCTCTTCCCAACATAACCCGTTAACCATTGTATGGGTGATGTCACATAGGTCACCTAATTCCGCTACATCTCTCCTCCGTAAGCGTTTCTTTGCGAAGGGACCAACTTTTTCCCTGTTAATTAAAAGCCGCGGAATGCGGAGTTTAACAATATTCACCAAGCTGGCAGATGGTGGGATCTTCAATGACGTCCCCATAATAATCGCGAGGTCACCCTTGGGAGAATCCTGGTAAGCTTGGGTGAAGGTTTTTGTCGGGTCGTCTCCCGGAAACACAAAATCTGGTTTCACAGGCCCGCAATATAAGATACGGCACGGATGGAGGGATCCAGGAACATCTCCCCGGCGTGGGTAGGGGGGGGGGGGGGGGGGGCGCAAACCGCGCGAGACGTGCAAAAAGGGGGCGGGGGGGCTACCAAACTTTGTTTGGGGGGGGGGGGGCCCGGCGCTAGATCTGGGCCGTCAATATGGGGGGGGGGGCCTTCAGGAAAAAAAGTGGGGGGGGGGACCTCCCCAGCCACAAAACGGGGGTGTTGGGGGCGCCCCGCCGTGGGTTCGTAAGGGGGGGAGGGGGGGTGAGGGGGGGGGGGGGTCTCCTTTGGGGGGGGTAGGGGGGGGGGGGGGGGCAGAGAGTAGGAGTGGGTGGGGCGGCACAAGGACC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTCCAGTTGCCTGCTCCGT