ORFeome > siva1 ORF1 – XORFeome v1.0

siva1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: siva1
Gene ID: 5854269
Gene Page ID: 5854214
ORF Xenbase ID: 17296497

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC128981
Original XGC clone length: 492

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: C08

Sequences - 5ʹ (forward) EST

Accession: JZ838585
dbEST ID: 79656287
Trimmed Sequence: ATGCCCAAGCGCTCGTACCCGTTTGACAGCGTTTCTCCCTTACAGCTCAAGACTCATGTTGGTGAGAAGGAGTTGTGCCAGGGTGTAGCCGGTGACACTCTCATGCGGGACATTTTCGAAAAGACCAAGATGTTGTTGTTCAAAGGAGCTAAAGCCGTTGTGGGAAAACAAGAGCACCAACGTGAAAATGGGCAGGACGTTTCTGTTCCTGAGCTCCCATCAGGACAGACTGTTATTGGACATGATGGCAAACTGTGCAGGAACACTCAGTTGCGCAAATCTACCCTGACAGGGGTATCCAAAGCCTGTTCTTCCTGTGTCAGATCTGTTGCTGCCAAAGAAACCTGCTCACAGTGTGAACGCTATGTTTGTAAACAGTGCTGCAAGGTATGCAGCTGTTGCTCTGCAATCATCTGCTCCTTCTGCACAGATGTTGACCATGACAACGGTGAAGGGTTGTTCTGCTCTGCCTGTTCTGTGTTTGAAGCGTT
Full Trace Sequence: TCGGGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCCAAGCGCTCGTACCCGTTTGACAGCGTTTCTCCCTTACAGCTCAAGACTCATGTTGGTGAGAAGGAGTTGTGCCAGGGTGTAGCCGGTGACACTCTCATGCGGGACATTTTCGAAAAGACCAAGATGTTGTTGTTCAAAGGAGCTAAAGCCGTTGTGGGAAAACAAGAGCACCAACGTGAAAATGGGCAGGACGTTTCTGTTCCTGAGCTCCCATCAGGACAGACTGTTATTGGACATGATGGCAAACTGTGCAGGAACACTCAGTTGCGCAAATCTACCCTGACAGGGGTATCCAAAGCCTGTTCTTCCTGTGTCAGATCTGTTGCTGCCAAAGAAACCTGCTCACAGTGTGAACGCTATGTTTGTAAACAGTGCTGCAAGGTATGCAGCTGTTGCTCTGCAATCATCTGCTCCTTCTGCACAGATGTTGACCATGACAACGGTGAAGGGTTGTTCTGCTCTGCCTGTTCTGTGTTTGAAGCGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCCATTTGTTGCCACGAACAGGTCCCTATCAGTCAAAATAAATTCTTATTTGCCATCCCGCTAAATCCCCTATAGTGAATTCGAATTAATTGGAGAAAAAAAAATTCCTGGCGGCTCTGGGCCCTGTTCTCGGTCTCCGGGTGTTCCAAAGNGGGNNTGTGTGNTGGTTNCNTNTTTGTGTGGTTGNTTGGTNTTGGCGGTTGTGTNTGTGGGTCTGGGNNGGNTGTGTGTGTGGTGGNGGGTGTGGCGTGGCGGCGCGCCACAAAAAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCAAGCGCTCGTA

Sequences - 3ʹ (reverse) EST

Accession: JZ838584
dbEST ID: 79656286
Trimmed Sequence: CGCTTCAAACACAGAACAGGCAGAACAAGAACAACCCTTCACCGTTGTCATGGTCAACATCTGTGCAGAAGGAGCAGATGATTGCAGAGCAACAGCTGCATACCTTGCAGCACTGTTTACAAACATAGCGTTCACACTGTGAGCAGGTTTCTTTGGCAGCAACAGATCTGACACAGGAAGAACAGGCTTTGGATACCCCTGTCAGGGTAGATTTGCGCAACTGAGTGTTCCTGCACAGTTTGCCATCATGTCCAATAACAGTCTGTCCTGATGGGAGCTCAGGAACAGAAACGTCCTGCCCATTTTCACGTTGGTGCTCTTGTTTTCCCACAACGGCTTTAGCTCCTTTGAACAACAACATCTTGGTCTTTTCGAAAATGTCCCGCATGAGAGTGTCACCGGCTACACCCTGGCACAACTCCTTCTCACCAACATGAGTCTTGAGCTGTAAGGGAGAAACGCTGTCATACGGGTACGAGCGCTTGGGCATGG
Full Trace Sequence: GAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACGCTTCAAACACAGAACAGGCAGAACAAGAACAACCCTTCACCGTTGTCATGGTCAACATCTGTGCAGAAGGAGCAGATGATTGCAGAGCAACAGCTGCATACCTTGCAGCACTGTTTACAAACATAGCGTTCACACTGTGAGCAGGTTTCTTTGGCAGCAACAGATCTGACACAGGAAGAACAGGCTTTGGATACCCCTGTCAGGGTAGATTTGCGCAACTGAGTGTTCCTGCACAGTTTGCCATCATGTCCAATAACAGTCTGTCCTGATGGGAGCTCAGGAACAGAAACGTCCTGCCCATTTTCACGTTGGTGCTCTTGTTTTCCCACAACGGCTTTAGCTCCTTTGAACAACAACATCTTGGTCTTTTCGAAAATGTCCCGCATGAGAGTGTCACCGGCTACACCCTGGCACAACTCCTTCTCACCAACATGAGTCTTGAGCTGTAAGGGAGAAACGCTGTCATACGGGTACGAGCGCTTGGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCAACAATTTGTGCCACGAAAAAGTCACCTATCAGTCAAAAAAAAAAACAAAAAAAAAAAACCAAAACTTAAAACCTGACCGTCGTTTTACAACAACAATGAACTGGGGGGNNNNNNNNANNNNNNNGNNNNNGGNNNNNNNNAAGGGGGGGGGGNAANNGAAAAAAAAANNNAAANNNNGGNNNNNGNGGNNNGNNNNNNNNGGGGGGGGGAAGAGAAAAAAAGAAGAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTTCAAACACAGAACAGGCA