ORFeome > six3 ORF1 – XORFeome v1.0

six3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: six3
Gene ID: 1021810
Gene Page ID: 478760
ORF Xenbase ID: 17296503

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC042277
Original XGC clone length: 735

Human orthology & disease relationships

NCBI Entrez ID: 6496
Ensembl gene IDs: ENSG00000138083
Directly associated (OMIM) disease MIM numbers: 157170,269160
Indirectly associated (Lage, et al.) disease MIM numbers: 157170

Library Location

Plate ID: GDExl11017
Well Location: C02

Sequences - 5ʹ (forward) EST

Accession: JZ824384
dbEST ID: 79642086
Trimmed Sequence: ATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAAGTAGCTGGCGTGTGCGAGACGCTAGAAGAGAGCGGCGACATTGAGCGTCTTGGTCGCTTCCTGTGGTCGTTGCCAGTCGCTCCTGCAGCCTGCGAGGCGCTAAATAAAAATGAGTCGGTCATCCGAGCCAGGGCGATCGTTGCCTTTCACACGGGCAATTTCAGGGATCTCTATCACATTGTGGAACATCACAAATTTACTAAGGAGTCGCACATGAAGCTGCAGGCGCTGTGGTTGGAGGCGCATTACCAAGAAGCAGAGAAGCTCAGGGGGAGACCTTTGGGGCCAGTAGACAAGTACAGGGTGAGGAAGAAGTTCCCTCTGCCCAGGACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACCAGACATTTGCTTAGGGAATGGTACTTACAAGATCCCTATCCGAATCCCGGCAAAAAAAGAGAACTCGCCCAGGCGACTGGACTTAGCGCAACACAAGTTGGAAACTGGTTCAAAAACCGCAGACAAAGAGACAGAGCGGCGGCAGCAAAGAACAGGCTGCAACAGCAGGTCTTGTCCCAGGGAAGTGGCCATTCATTGAGTCCAGATGATAGAGGAGAAACGCTGGGCTCAGCCTCCAGTCCTGCGGCAAGTCTGTCCAGCANNAGCGCTACCTCTGCCATCTCCATCACATCAGGCGACAGTGAATGTGACATCTTGCCACTTTCTTTTGTCCAAAGTTGGCAATATAAGAAAAGCATGTCTTATTAATTGTTTTGACCGAAAAGGGTCCCTTTCGTTTCAAAAAAAATCATTTTTTTCCCTTCGC
Full Trace Sequence: ATTTTTATTTTTCGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTTCAGCTGCCTATTCTGAACTTCAGCCCCCAGCAAGTAGCTGGCGTGTGCGAGACGCTAGAAGAGAGCGGCGACATTGAGCGTCTTGGTCGCTTCCTGTGGTCGTTGCCAGTCGCTCCTGCAGCCTGCGAGGCGCTAAATAAAAATGAGTCGGTCATCCGAGCCAGGGCGATCGTTGCCTTTCACACGGGCAATTTCAGGGATCTCTATCACATTGTGGAACATCACAAATTTACTAAGGAGTCGCACATGAAGCTGCAGGCGCTGTGGTTGGAGGCGCATTACCAAGAAGCAGAGAAGCTCAGGGGGAGACCTTTGGGGCCAGTAGACAAGTACAGGGTGAGGAAGAAGTTCCCTCTGCCCAGGACTATTTGGGACGGGGAACAGAAGACTCACTGCTTTAAAGAACGAACCAGACATTTGCTTAGGGAATGGTACTTACAAGATCCCTATCCGAATCCCGGCAAAAAAAGAGAACTCGCCCAGGCGACTGGACTTAGCGCAACACAAGTTGGAAACTGGTTCAAAAACCGCAGACAAAGAGACAGAGCGGCGGCAGCAAAGAACAGGCTGCAACAGCAGGTCTTGTCCCAGGGAAGTGGCCATTCATTGAGTCCAGATGATAGAGGAGAAACGCTGGGCTCAGCCTCCAGTCCTGCGGCAAGTCTGTCCAGCANNAGCGCTACCTCTGCCATCTCCATCACATCAGGCGACAGTGAATGTGACATCTTGCCACTTTCTTTTGTCCAAAGTTGGCAATATAAGAAAAGCATGTCTTATTAATTGTTTTGACCGAAAAGGGTCCCTTTCGTTTCAAAAAAAATCATTTTTTTCCCTTCGC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTCAGCTGCCTATTCTGAAC

Sequences - 3ʹ (reverse) EST

Accession: JZ829743
dbEST ID: 79647445
Trimmed Sequence: GATGTCACATTCACTGTCGCTGGATGTGATGGAGATGGCAGAGGTAGCCGCTTTGCTGGACAGACTTGCCGCAGGACTGGAGGCTGAGCCCAGCGTTTCTCCTCTATCATCTGGACCCAATGAATGGCCACTTCCCTGGGACAAGACCTGCTGTTGCAGCCTGTTCTTTGCTGCCGCCGCTCTGTCTCTTTGTCTGCGGTTTTTGAACCAGTTTCCAACTTGTGTTGCGCTAAGTCCAGTCGCCTGGGCGAGTTCTCTTTTTTTGCCGGGATTCGGATAGGGATCTTGTAAGTACCATTCCCTAAGCAAATGTCTGGTTCGTTCTTTAAAGCAGTGAGTCTTCTGTTCCCCGTCCCAAATAGTCCTGGGCAGAGGGAACTTCTTCCTCACCCTGTACTTGTCTACTGGCCCCAAAGGTCTCCCCCTGAGCTTCTCTGCTTCTTGGTAATGCGCCTCCGACCACAGCGCCTGCAGCTTCATGTGCGACTCCATAGTACATTTGTGATGTTCCACAATGTGATAGAGATCCCTGAAATTGCCCGTGTGAAAGGCAACGATCGCCCTGGCTCGCATGACCGACTCATTTTGATTTAGCGCCTCGCACGCTGCAGGAGCGACTGGCAACGACCAAAAGGAAGCGACCAAGACTCTCAATGTCGCCGCTCTCTTCCTACCGTCTCGCACCCCCCCGCTACTTGCTGGGGGGCCGAAATTTCAGAAAAAGGGCACCTGAAACCAAGGGGGCCCCACCTTCTTTGTGGTACCAAGGT
Full Trace Sequence: TGCCGGGTATCAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGTCACATTCACTGTCGCTGGATGTGATGGAGATGGCAGAGGTAGCCGCTTTGCTGGACAGACTTGCCGCAGGACTGGAGGCTGAGCCCAGCGTTTCTCCTCTATCATCTGGACCCAATGAATGGCCACTTCCCTGGGACAAGACCTGCTGTTGCAGCCTGTTCTTTGCTGCCGCCGCTCTGTCTCTTTGTCTGCGGTTTTTGAACCAGTTTCCAACTTGTGTTGCGCTAAGTCCAGTCGCCTGGGCGAGTTCTCTTTTTTTGCCGGGATTCGGATAGGGATCTTGTAAGTACCATTCCCTAAGCAAATGTCTGGTTCGTTCTTTAAAGCAGTGAGTCTTCTGTTCCCCGTCCCAAATAGTCCTGGGCAGAGGGAACTTCTTCCTCACCCTGTACTTGTCTACTGGCCCCAAAGGTCTCCCCCTGAGCTTCTCTGCTTCTTGGTAATGCGCCTCCGACCACAGCGCCTGCAGCTTCATGTGCGACTCCATAGTACATTTGTGATGTTCCACAATGTGATAGAGATCCCTGAAATTGCCCGTGTGAAAGGCAACGATCGCCCTGGCTCGCATGACCGACTCATTTTGATTTAGCGCCTCGCACGCTGCAGGAGCGACTGGCAACGACCAAAAGGAAGCGACCAAGACTCTCAATGTCGCCGCTCTCTTCCTACCGTCTCGCACCCCCCCGCTACTTGCTGGGGGGCCGAAATTTCAGAAAAAGGGCACCTGAAACCAAGGGGGCCCCACCTTCTTTGTGGTACCAAGGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTCACATTCACTGTCGCT