ORFeome > ski ORF1 – XORFeome v1.0

ski ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ski
Gene ID: 6254672
Gene Page ID: 494027
ORF Xenbase ID: 17296515

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC072137
Original XGC clone length: 2148

Human orthology & disease relationships

NCBI Entrez ID: 6497
Ensembl gene IDs: ENSG00000157933
Directly associated (OMIM) disease MIM numbers: 182212
Indirectly associated (Lage, et al.) disease MIM numbers: 146510,174200,174700,174900,175050,175700,200990,260350,306955,609192,609637

Library Location

Plate ID: GDExl11031
Well Location: A01

Sequences - 5ʹ (forward) EST

Accession: JZ826133
dbEST ID: 79643835
Trimmed Sequence: ATGGAGACCGTGAGCCGCAGCAGTTTCCAGCCCCACGCCGGGCTCCAGAAGACCCTGGAACAGTTTCACCTGAGCTCTATGAGTTCTCTGGGCGGTCCGGCCGCCTTCTCCGCCCGCTGGACTCAGGACTTGTACAAGAAGGAGTGCGGCAAGGAGCCCCCGGAGCCCATACTCCACCTGCCCAGCCAGCCGCCTCCGGTCATCCCCGGGGGTCCCCTATTTATGCCGTCGGACCGTTCCACTGAGAGGTGTGAGACTATTCTGGAGGGGGAGACCATCTCTTGCTTTGTGGTGGGGGGCGAGAAGCGACTGTGTCTCCCTCAGATCCTCAACTCGGTGCTGCGGGATTTCAGCCTTCAGCAGATCAACGCCGTGTGCGACGAGTTGCACGTGTATTGCTCCCGCTGCACGGCCGACCAGGCTGGAGATCCTGAAGGTGATGGGGATCCTGCCCTTCTCCGCGCCCTCCTGTGGCCTCATCACCAAGACGGACGCCGAGCGCCTGTGCAACGCCCTGATGTACGGGGGGAGCTACCCGCCCCGCTGCGCCAAGAAGAGCGACTTCCCGCCGGGACGCTTAGAGCTGGAGCTGACCGAGGGCAGTTTCAAGGTGTATCACGAGTGCTTCCGAAAGTGTCGGGGGCCTGTTCGTGCCCGAGCTTGACCGACACCCCAGCGCCCCCTGGTATTCCGTGCTTGGAATGTTCCCCTCTGTACCCGCCGGCAACAAGGTTGTGG
Full Trace Sequence: TGGGTCTAGGTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGACCGTGAGCCGCAGCAGTTTCCAGCCCCACGCCGGGCTCCAGAAGACCCTGGAACAGTTTCACCTGAGCTCTATGAGTTCTCTGGGCGGTCCGGCCGCCTTCTCCGCCCGCTGGACTCAGGACTTGTACAAGAAGGAGTGCGGCAAGGAGCCCCCGGAGCCCATACTCCACCTGCCCAGCCAGCCGCCTCCGGTCATCCCCGGGGGTCCCCTATTTATGCCGTCGGACCGTTCCACTGAGAGGTGTGAGACTATTCTGGAGGGGGAGACCATCTCTTGCTTTGTGGTGGGGGGCGAGAAGCGACTGTGTCTCCCTCAGATCCTCAACTCGGTGCTGCGGGATTTCAGCCTTCAGCAGATCAACGCCGTGTGCGACGAGTTGCACGTGTATTGCTCCCGCTGCACGGCCGACCAGGCTGGAGATCCTGAAGGTGATGGGGATCCTGCCCTTCTCCGCGCCCTCCTGTGGCCTCATCACCAAGACGGACGCCGAGCGCCTGTGCAACGCCCTGATGTACGGGGGGAGCTACCCGCCCCGCTGCGCCAAGAAGAGCGACTTCCCGCCGGGACGCTTAGAGCTGGAGCTGACCGAGGGCAGTTTCAAGGTGTATCACGAGTGCTTCCGAAAGTGTCGGGGGCCTGTTCGTGCCCGAGCTTGACCGACACCCCAGCGCCCCCTGGTATTCCGTGCTTGGAATGTTCCCCTCTGTACCCGCCGGCAACAAGGTTGTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACCGTGAGCCGCAG

Sequences - 3ʹ (reverse) EST

Accession: JZ826132
dbEST ID: 79643834
Trimmed Sequence: GTTTTCAATGTCTTTCCTTGTGTGTTCACTGCTGGGAAGATGGCTGGTCTTTGACCAAAGCTGTTCCTGGAGGTCTTTCACCACTTTTTCCAAGTGTTCTCTGGCTTCTCGTTCATGTACTATATCTGTCCGTAGCTGTTCTCTGTCATTTTCTGCATGCTGAAGCTTAGACTGCAGCTCCTCAATCTGGGCAGAGTATTTGACCCGTATCCTGCCAGCTTCACAGCCTTTGTCACACACCCGAATCTGTCTGGCTTGCTCCAGCTCTCTTTTCAGACGTAACCGAGATTCATTCGCTTCTTTCATTTTCTTTTCATGCTCTGCTCTCAAACGCTCAATCTCTTTCCTCAAGTTGCGCTTTGCCTCAGTTGCCTCTCTTAACTTCTCTTTTTTAGCAACTCGCAGGAACTCCAACTCCTGCTGAAGACTTCTCTTGGCCTGCAAAGCAGCATTGAGTTTCTCTTCTTGTTTCACTCGCATTTTTACAACTTCGTGGAGGAATTTCTCTTTGGCTTCCTTAGAATCTAGACCACTGTCCAGGGCTTGCTTCAGGTGCTCCAGTTCAGCTTCCAGTCCACTGCAATGTTGATCATTGTGAAAAGCTACCTCATACGATGTGTTGATCACAGTTTGTGCTAGCATGCCCGGGGAACTTAATTTCTTTTGCTGAACTTGACAATGTTAAGGGAAGGAAAATGAAAAGTTGAAAAAAA
Full Trace Sequence: CGGGGAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTTTTCAATGTCTTTCCTTGTGTGTTCACTGCTGGGAAGATGGCTGGTCTTTGACCAAAGCTGTTCCTGGAGGTCTTTCACCACTTTTTCCAAGTGTTCTCTGGCTTCTCGTTCATGTACTATATCTGTCCGTAGCTGTTCTCTGTCATTTTCTGCATGCTGAAGCTTAGACTGCAGCTCCTCAATCTGGGCAGAGTATTTGACCCGTATCCTGCCAGCTTCACAGCCTTTGTCACACACCCGAATCTGTCTGGCTTGCTCCAGCTCTCTTTTCAGACGTAACCGAGATTCATTCGCTTCTTTCATTTTCTTTTCATGCTCTGCTCTCAAACGCTCAATCTCTTTCCTCAAGTTGCGCTTTGCCTCAGTTGCCTCTCTTAACTTCTCTTTTTTAGCAACTCGCAGGAACTCCAACTCCTGCTGAAGACTTCTCTTGGCCTGCAAAGCAGCATTGAGTTTCTCTTCTTGTTTCACTCGCATTTTTACAACTTCGTGGAGGAATTTCTCTTTGGCTTCCTTAGAATCTAGACCACTGTCCAGGGCTTGCTTCAGGTGCTCCAGTTCAGCTTCCAGTCCACTGCAATGTTGATCATTGTGAAAAGCTACCTCATACGATGTGTTGATCACAGTTTGTGCTAGCATGCCCGGGGAACTTAATTTCTTTTGCTGAACTTGACAATGTTAAGGGAAGGAAAATGAAAAGTTGAAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTCAATGTCTTTCCTTGTGTG