ORFeome > skp1 ORF1 – XORFeome v1.0

skp1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: skp1
Gene ID: 919643
Gene Page ID: 919630
ORF Xenbase ID: 17296521

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054184
Original XGC clone length: 492

Human orthology & disease relationships

NCBI Entrez ID: 6500
Ensembl gene IDs: ENSG00000113558
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 256000,300291,300301,300584,308300,609283

Library Location

Plate ID: GDExl11001
Well Location: A03

Sequences - 5ʹ (forward) EST

Accession: JZ839062
dbEST ID: 79656764
Trimmed Sequence: ATGCCTTCTATCAAACTGCAGAGTTCTGATGGAGAGATTTTTGAAGTGGATGTTGAAATTGCAAAGCAGTCCGTAACAATTAAAACTATGTTGGAAGATCTGGGTATGGATGACGAAGGTGATGATGATCCTGTGCCACTTCCCAATGTTAACGCTGCAATTCTTAAAAAAGTCATCCAGTGGTGTACACATCATAAAGATGATCCCCCACCACCCGAAGATGATGAAAACAAAGAGAAGAGAACAGATGATATCCCTGTATGGGATCAAGAGTTTTTAAAAGTGGACCAGGGAACACTATTTGAACTTATTTTGGCTGCCAACTATTTGGATATCAAAGGATTGCTTGATGTCACCTGCAAGACAGTCGCAAACATGATTAAAGGAAAAACACCAGAGGAAATTCGAAAGACCTTCAACATCAAAAACGACTTTACTGAGGAGGAAGAAGCTCAGGTACGCAAAGAGAATCAGTGGTGTGAAGAAAAGTT
Full Trace Sequence: GCTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCCTTCTATCAAACTGCAGAGTTCTGATGGAGAGATTTTTGAAGTGGATGTTGAAATTGCAAAGCAGTCCGTAACAATTAAAACTATGTTGGAAGATCTGGGTATGGATGACGAAGGTGATGATGATCCTGTGCCACTTCCCAATGTTAACGCTGCAATTCTTAAAAAAGTCATCCAGTGGTGTACACATCATAAAGATGATCCCCCACCACCCGAAGATGATGAAAACAAAGAGAAGAGAACAGATGATATCCCTGTATGGGATCAAGAGTTTTTAAAAGTGGACCAGGGAACACTATTTGAACTTATTTTGGCTGCCAACTATTTGGATATCAAAGGATTGCTTGATGTCACCTGCAAGACAGTCGCAAACATGATTAAAGGAAAAACACCAGAGGAAATTCGAAAGACCTTCAACATCAAAAACGACTTTACTGAGGAGGAAGAAGCTCAGGTACGCAAAGAGAATCAGTGGTGTGAAGAAAAGTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCAGCTGATATCCCCAATATTGAGTCGTATTACATGGTCATAAGCTGTAACAAGGCAGAACAAAACAGTGTCTCAAAATCTCTAATGTTAAAAAGGGGNGGNTGTGNTNGNNTTTTCGGCTCCCTCGGGGGCGGGGGGGGCGTGGGTTTCTTGGGTGGGGTGTGGGGGGCGCACCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTTCTATCAAACTGCAGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ839061
dbEST ID: 79656763
Trimmed Sequence: CTTTTCTTCACACCACTGATTCTCTTTGCGTACCTGAGCTTCTTCCTCCTCAGTAAAGTCGTTTTTGATGTTGAAGGTCTTTCGAATTTCCTCTGGTGTTTTTCCTTTAATCATGTTTGCGACTGTCTTGCAGGTGACATCAAGCAATCCTTTGATATCCAAATAGTTGGCAGCCAAAATAAGTTCAAATAGTGTTCCCTGGTCCACTTTTAAAAACTCTTGATCCCATACAGGGATATCATCTGTTCTCTTCTCTTTGTTTTCATCATCTTCGGGTGGTGGGGGATCATCTTTATGATGTGTACACCACTGGATGACTTTTTTAAGAATTGCAGCGTTAACATTGGGAAGTGGCACAGGATCATCATCACCTTCGTCATCCATACCCAGATCTTCCAACATAATTTTAATTGTTACGGACTGCTTTGCAATTTCAACATCCACTTTCAAAATCTCTCCATCAGAACTCTGCAGTTTGATAGAAGGCATGG
Full Trace Sequence: GCAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTTCTTCACACCACTGATTCTCTTTGCGTACCTGAGCTTCTTCCTCCTCAGTAAAGTCGTTTTTGATGTTGAAGGTCTTTCGAATTTCCTCTGGTGTTTTTCCTTTAATCATGTTTGCGACTGTCTTGCAGGTGACATCAAGCAATCCTTTGATATCCAAATAGTTGGCAGCCAAAATAAGTTCAAATAGTGTTCCCTGGTCCACTTTTAAAAACTCTTGATCCCATACAGGGATATCATCTGTTCTCTTCTCTTTGTTTTCATCATCTTCGGGTGGTGGGGGATCATCTTTATGATGTGTACACCACTGGATGACTTTTTTAAGAATTGCAGCGTTAACATTGGGAAGTGGCACAGGATCATCATCACCTTCGTCATCCATACCCAGATCTTCCAACATAATTTTAATTGTTACGGACTGCTTTGCAATTTCAACATCCACTTTCAAAATCTCTCCATCAGAACTCTGCAGTTTGATAGAAGGCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAACATTGCTCCATCATTTTGTTGCAACGAAAAAGTCACTATCAATCAAAATAAAAATCATTTTTTGGGAAAAGAACATAAGACTGGACCGTCGATTTAACAACGCCTTGACCTGGGCTGGTTTCCTGGCAACACGGGTCCCGAGTTGGAGAAAATTTGTTTGAATTTAAAAAAANGGGAAGTAGGAGNGNNNTNNTNCNAGGGAAAAAAGAAAAGATAAAAAAAAAAAAGGTAA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTTCTTCACACCACTGATTCT