ORFeome > slbp ORF1 – XORFeome v1.0

slbp ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: slbp
Gene ID: 6077488
Gene Page ID: 480368
ORF Xenbase ID: 17296545

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC114222
Original XGC clone length: 765

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: H11

Sequences - 5ʹ (forward) EST

Accession: JZ837709
dbEST ID: 79655411
Trimmed Sequence: ATGTCGGACCACTGGCGCACTATCAGCGAGGAACACAGGCCTCATGCACCCTCTCGCTGGTCACAAGGAAGGAAGCGATGCTCAGACGGAAAACTGAGACGTCACGATGATACAGATTCCACAGTTTTTGATACTAAGCCTTCCGAAGAACCTCAAGCGAGGCCTGACAGCTTTACAACCCCTGAAAGTCATAAGCCAGTGGCAAGATGCAAAGACTGGGGCAGTGCAGTGGAAGAAGATGAGCAGCTGAGGGAAAAAGTTGACCAAGACATAGCTCGATACAGGAGGAAACTTCTGATTAATGAATTTGGCAGAAGAGAAAGGAGATCATCGTCTGGAAGTTCTGATTCAAAGGATTCATCTACACATGGAGAGATGGAAACTGACCCAGCTGTAATTACAAGAAGACAGAAGCAGATTAACTATGGGAAAAATACGATTGCATATGATCGATACATTAAGGCAGTGCCAAGACATCTTCGAGAGCCTAATGTTCATCCTAGAACTCCCAATAAGTTCAAAAAATACAGCCGCAGATCTTGGGACCAGCAAATCAGGCTGTGGAGAATTGCTCTACATCAATGGGACCCTCCTGCCACGGAAGGCAGTGACTTGCAGCCTTTTTATGAAAAAAAAATGGTTCTCGCCGAAACAACTTTCTCAAGACACCTATTCACAG
Full Trace Sequence: TCGTGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTCGGACCACTGGCGCACTATCAGCGAGGAACACAGGCCTCATGCACCCTCTCGCTGGTCACAAGGAAGGAAGCGATGCTCAGACGGAAAACTGAGACGTCACGATGATACAGATTCCACAGTTTTTGATACTAAGCCTTCCGAAGAACCTCAAGCGAGGCCTGACAGCTTTACAACCCCTGAAAGTCATAAGCCAGTGGCAAGATGCAAAGACTGGGGCAGTGCAGTGGAAGAAGATGAGCAGCTGAGGGAAAAAGTTGACCAAGACATAGCTCGATACAGGAGGAAACTTCTGATTAATGAATTTGGCAGAAGAGAAAGGAGATCATCGTCTGGAAGTTCTGATTCAAAGGATTCATCTACACATGGAGAGATGGAAACTGACCCAGCTGTAATTACAAGAAGACAGAAGCAGATTAACTATGGGAAAAATACGATTGCATATGATCGATACATTAAGGCAGTGCCAAGACATCTTCGAGAGCCTAATGTTCATCCTAGAACTCCCAATAAGTTCAAAAAATACAGCCGCAGATCTTGGGACCAGCAAATCAGGCTGTGGAGAATTGCTCTACATCAATGGGACCCTCCTGCCACGGAAGGCAGTGACTTGCAGCCTTTTTATGAAAAAAAAATGGTTCTCGCCGAAACAACTTTCTCAAGACACCTATTCACAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGGACCACTGGCGCACT

Sequences - 3ʹ (reverse) EST

Accession: JZ837708
dbEST ID: 79655410
Trimmed Sequence: ACTAAGCAATTCCTCCTCAATAAAGCAGGGTTCCAGATCAAAGGCATCGTCTGCTTCAACTTTTCGGACCTTAGTAGGAGTGCCTGTGAATAGGTTCTCTTGAGAACTTGTTTCTGTGCAGACCATATCTTCTTCCATAAAAGGCTGCAAGTCACTGCCTTCCGCTGCAGGAGGGTCCCACTGATGTAGAGCAATTCTCCACAGCCTGATTTGCTGGTCCCAAGATCTGCGGCTGTATTTTTTGAACTTATTGGGAGTTCTAGGATGAACATTAGGCTCTCGAAGATGTCTTGGCACTGCCTTAATGTATCGATCATATGCAATCGTATTTTTCCCATAGTTAATCTGCTTCTGTCTTCTTGTAATTACAGCTGGGTCAGTTTCCATCTCTCCATGTGTAGATGAATCCTTTGAATCACAACTTCCAGACGATGATCTCCTTTCTCTTCTGCCAAATTCATTAATCAAAAATTTCCTCCTGTATCGAGCTATGTCTTGGTCGGCTTTTTCCCTCAGCTGCTCATCTTCTTCCACTGCACTGGCCGGGTCTTTGCATCTTGGCGGTGGCTTAGGACATTCAGGGGTTGTAAAGCTGTCGGGGCTCGCTTTAAGTTCGTTCGGAAGGCGTAAGTATAGAAACTGTGGAATGGGTATCATCGTGAGCGCGGGGTTTTCCGTCTGAGCAGCACGTTCGTTCCTTGGAACGGGGAGAAGGTGGAAGGAGACGGGGGTCCGCGCTTATAAAGACACAGTGGTGCCACGAAAAGGCCCGCGTTTTTTTACATATTGGGAGTAGAGAAAAAAATAGTCATCAATTTGTTCAACGGAGGGGGCAGGTTAGGAAAAAAAAAAAAAAAAAAAAAAAAACAAAGATAAAATCTTCCACAAGGTGAGAAGGGCGGGACTATAATAGGTGGCGGCGGAGGGGGGGGGGGGCCCCGGTTATATAAGGTTAGGGGGGGGACGCGCCAG
Full Trace Sequence: GGGCCGGGGAACAGCCAATGAACATGGTAAAACGACTCACTATACGGGGAAACCAGCCAGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACTAAGCAATTCCTCCTCAATAAAGCAGGGTTCCAGATCAAAGGCATCGTCTGCTTCAACTTTTCGGACCTTAGTAGGAGTGCCTGTGAATAGGTTCTCTTGAGAACTTGTTTCTGTGCAGACCATATCTTCTTCCATAAAAGGCTGCAAGTCACTGCCTTCCGCTGCAGGAGGGTCCCACTGATGTAGAGCAATTCTCCACAGCCTGATTTGCTGGTCCCAAGATCTGCGGCTGTATTTTTTGAACTTATTGGGAGTTCTAGGATGAACATTAGGCTCTCGAAGATGTCTTGGCACTGCCTTAATGTATCGATCATATGCAATCGTATTTTTCCCATAGTTAATCTGCTTCTGTCTTCTTGTAATTACAGCTGGGTCAGTTTCCATCTCTCCATGTGTAGATGAATCCTTTGAATCACAACTTCCAGACGATGATCTCCTTTCTCTTCTGCCAAATTCATTAATCAAAAATTTCCTCCTGTATCGAGCTATGTCTTGGTCGGCTTTTTCCCTCAGCTGCTCATCTTCTTCCACTGCACTGGCCGGGTCTTTGCATCTTGGCGGTGGCTTAGGACATTCAGGGGTTGTAAAGCTGTCGGGGCTCGCTTTAAGTTCGTTCGGAAGGCGTAAGTATAGAAACTGTGGAATGGGTATCATCGTGAGCGCGGGGTTTTCCGTCTGAGCAGCACGTTCGTTCCTTGGAACGGGGAGAAGGTGGAAGGAGACGGGGGTCCGCGCTTATAAAGACACAGTGGTGCCACGAAAAGGCCCGCGTTTTTTTACATATTGGGAGTAGAGAAAAAAATAGTCATCAATTTGTTCAACGGAGGGGGCAGGTTAGGAAAAAAAAAAAAAAAAAAAAAAAAACAAAGATAAAATCTTCCACAAGGTGAGAAGGGCGGGACTATAATAGGTGGCGGCGGAGGGGGGGGGGGGCCCCGGTTATATAAGGTTAGGGGGGGGACGCGCCAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTAAGCAATTCCTCCTCAATAAA